Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 1 to 20 of 46

1.

rs17884057 [Homo sapiens]
    CTTTAGAAACCAAAAAAAGAGAAGA[-/AGA]TCAACCTTAAGATTAGCCACAAAAC
    Chromosome:
    21:31664502
    Gene:
    SOD1 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by cluster,by frequency
    Global MAF:
    -=0.0855/428
    HGVS:
    CM000683.2:g.31664502_31664504delAGA, NC_000021.8:g.33036815_33036817delAGA, NC_000021.9:g.31664502_31664504delAGA, NG_008689.1:g.9881_9883delAGA, NM_000454.4:c.169+616_169+618delAGA
    2.

    rs17881426 [Homo sapiens]
      ATCAATCCCTCTGGAAATACCTCGG[A/C/T]GGCATGGCTGGCCTTATTCTACAGG
      Chromosome:
      4:24797878
      Gene:
      SOD3 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by cluster,by frequency
      Global MAF:
      A=0.1875/939
      HGVS:
      CM000666.2:g.24797878T>A, CM000666.2:g.24797878T>C, NC_000004.11:g.24799500T>A, NC_000004.12:g.24797878T>A, NC_000004.12:g.24797878T>C, NG_012213.1:g.7416T>A, NG_012213.1:g.7416T>C, NM_003102.2:c.-16-1628T>A, NM_003102.2:c.-16-1628T>C, XR_427488.1:n.175-1628T>A, XR_427488.1:n.175-1628T>C
      3.

      rs17878863 [Homo sapiens]
        TAAGGGCCCCTGTCCTCTTTCTCTG[A/G/T]TAACACTGTCCTCTTTCTCTGATAA
        Chromosome:
        4:24796196
        Gene:
        SOD3 (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by 1000G,by cluster,by frequency
        Global MAF:
        G=0.0256/128
        HGVS:
        CM000666.2:g.24796196A>G, CM000666.2:g.24796196A>T, NC_000004.11:g.24797818A>G, NC_000004.12:g.24796196A>G, NC_000004.12:g.24796196A>T, NG_012213.1:g.5734A>G, NG_012213.1:g.5734A>T, NM_003102.2:c.-17+545A>G, NM_003102.2:c.-17+545A>T, XR_427488.1:n.174+545A>G, XR_427488.1:n.174+545A>T
        5.

        rs10432782 [Homo sapiens]
          CTTAGCCTTGACCTCCCAGGCTCCA[G/T]TGATCCTCATGCCTTGGCCCGTAGC
          Chromosome:
          21:31664078
          Gene:
          SOD1 (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency
          Global MAF:
          G=0.2949/1477
          HGVS:
          CM000683.2:g.31664078T>G, NC_000021.8:g.33036391T>G, NC_000021.9:g.31664078T>G, NG_008689.1:g.9457T>G, NM_000454.4:c.169+192T>G
          6.

          rs9967983 [Homo sapiens]
            GTACTTTGGAATATGCTTAAAAAAA[A/T]TTTTTTTAAAGTATTTTTAAAAAAT
            Chromosome:
            21:31665169
            Gene:
            SOD1 (GeneView)
            Functional Consequence:
            intron variant
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency
            Global MAF:
            A=0.4301/2154
            HGVS:
            CM000683.2:g.31665169A>T, NC_000021.8:g.33037482A>T, NC_000021.9:g.31665169A>T, NG_008689.1:g.10548A>T, NM_000454.4:c.170-1280A>T
            8.

            rs8192291 [Homo sapiens]
              CTGCCAGGTGCAGCCGTCGGCCACG[C/T]TGGACGCCGCGCAGCCCCGGGTGAC
              Chromosome:
              4:24799732
              Gene:
              SOD3 (GeneView)
              Functional Consequence:
              nc transcript variant,synonymous codon
              Validated:
              by 1000G,by cluster,by frequency
              Global MAF:
              T=0.1985/994
              HGVS:
              CM000666.2:g.24799732C>T, NC_000004.11:g.24801354C>T, NC_000004.12:g.24799732C>T, NG_012213.1:g.9270C>T, NM_003102.2:c.211C>T, NP_003093.2:p.Leu71, XR_427488.1:n.401C>T
              9.

              rs8192288 [Homo sapiens]
                AAAAGGAGGTGCAGGGAGTGGTGCA[A/G/T]CTGCTTCAGGCGTACACAGATAGGA
                Chromosome:
                4:24795056
                Gene:
                SOD3 (GeneView)
                Functional Consequence:
                upstream variant 2KB
                Validated:
                by 1000G,by cluster,by frequency
                Global MAF:
                T=0.0737/369
                HGVS:
                CM000666.2:g.24795056G>A, CM000666.2:g.24795056G>T, NC_000004.11:g.24796678G>T, NC_000004.12:g.24795056G>A, NC_000004.12:g.24795056G>T, NG_012213.1:g.4594G>A, NG_012213.1:g.4594G>T, NM_003102.2:c.-612G>A, NM_003102.2:c.-612G>T, XR_427488.1:n.-422G>A, XR_427488.1:n.-422G>T
                10.

                rs8192287 [Homo sapiens]
                  TGCGGCTAGTGCCAGCCACTGTGTT[G/T]TCACTGGGCGAGTAATGATCTCATT
                  Chromosome:
                  4:24794946
                  Gene:
                  SOD3 (GeneView)
                  Functional Consequence:
                  upstream variant 2KB
                  Validated:
                  by 1000G,by cluster,by frequency
                  Global MAF:
                  T=0.0733/367
                  HGVS:
                  CM000666.2:g.24794946G>T, NC_000004.11:g.24796568G>T, NC_000004.12:g.24794946G>T, NG_012213.1:g.4484G>T, NM_003102.2:c.-722G>T, XR_427488.1:n.-532G>T
                  11.
                  12.

                  rs7732671 [Homo sapiens]
                    GGCGGACAGCACCCAAGACAAGAAG[C/G]CTCCCATGATGCAGTCTCAGAGCCG
                    Chromosome:
                    5:149832680
                    Gene:
                    PPARGC1B (GeneView)
                    Functional Consequence:
                    missense,utr variant 5 prime
                    Allele Origin:
                    G(germline)/C(germline)
                    Clinical significance:
                    other
                    Validated:
                    by 1000G,by 2hit 2allele,by cluster,by frequency
                    Global MAF:
                    C=0.1096/549
                    HGVS:
                    CM000667.2:g.149832680G>C, NC_000005.10:g.149832680G>C, NC_000005.9:g.149212243G>C, NG_016747.1:g.107429G>C, NM_001172698.1:c.490G>C, NM_001172699.1:c.415G>C, NM_133263.3:c.607G>C, NP_001166169.1:p.Ala164Pro, NP_001166170.1:p.Ala139Pro, NP_573570.3:p.Ala203Pro, XP_005268429.1:p.Ala182Pro, XP_011535855.1:p.Ala203Pro, XP_011535856.1:p.Ala182Pro, XP_011535857.1:p.Ala164Pro, XP_011535859.1:p.Ala203Pro
                    13.

                    rs5747136 [Homo sapiens]
                      GTATATGAGGGGAGTTACTGAAGTA[C/G]GGAGTAAAAAAAGGAAAGAAAATTG
                      Chromosome:
                      22:17440126
                      Gene:
                      CECR2 (GeneView)
                      Functional Consequence:
                      intron variant
                      Validated:
                      no info
                      HGVS:
                      CM000684.2:g.17440126G>C, NC_000022.10:g.17919170G>C, NC_000022.11:g.17440126G>C, NG_033989.1:g.85178G>C, NM_001290046.1:c.-363-37462G>C, NM_001290047.1:c.127-37462G>C, XR_951200.2:n.233-37462G>C, XR_951201.2:n.233-37462G>C
                      14.

                      rs5746138 [Homo sapiens]
                        atgtttatttgcagggcgccaagca[A/G]ggagaattgggcagctcatgcttga
                        Chromosome:
                        6:159681820
                        Gene:
                        SOD2 (GeneView)
                        Functional Consequence:
                        intron variant,utr variant 3 prime
                        Validated:
                        by 1000G,by cluster,by frequency
                        Global MAF:
                        C=0.0415/208
                        HGVS:
                        CM000668.2:g.159681820T>C, NC_000006.11:g.160102852T>C, NC_000006.12:g.159681820T>C, NG_008729.2:g.50536A>G, NG_008729.3:g.85710A>G, NM_000636.3:c.*673A>G, NM_001024465.2:c.*19+654A>G, NM_001024466.2:c.*19+654A>G, NM_001322814.1:c.*673A>G, NM_001322815.1:c.*673A>G, NM_001322817.1:c.*19+654A>G, NM_001322819.1:c.*673A>G, NM_001322820.1:c.*673A>G
                        15.

                        rs5746136 [Homo sapiens]
                          TCTATAGAAAATTGCACTTTTTGTC[A/G]AGTAATCCTCTGCAGTGATACTTCT
                          Chromosome:
                          6:159682052
                          Gene:
                          SOD2 (GeneView)
                          Functional Consequence:
                          intron variant,utr variant 3 prime
                          Validated:
                          by 1000G,by 2hit 2allele,by cluster,by frequency
                          Global MAF:
                          T=0.3057/1531
                          HGVS:
                          CM000668.2:g.159682052C>T, NC_000006.11:g.160103084C>T, NC_000006.12:g.159682052C>T, NG_008729.2:g.50304G>A, NG_008729.3:g.85478G>A, NM_000636.3:c.*441G>A, NM_001024465.2:c.*19+422G>A, NM_001024466.2:c.*19+422G>A, NM_001322814.1:c.*441G>A, NM_001322815.1:c.*441G>A, NM_001322817.1:c.*19+422G>A, NM_001322819.1:c.*441G>A, NM_001322820.1:c.*441G>A
                          17.
                          19.

                          rs4998557 [Homo sapiens]
                            CATTACCTGAATGGCTATACTGCTT[A/G]CTTTCATTTTGGTAGAGTGGAAAGG
                            Chromosome:
                            21:31662579
                            Gene:
                            SOD1 (GeneView)
                            Functional Consequence:
                            intron variant
                            Validated:
                            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                            Global MAF:
                            A=0.3291/1648
                            HGVS:
                            CM000683.2:g.31662579G>A, NC_000021.8:g.33034892G>A, NC_000021.9:g.31662579G>A, NG_008689.1:g.7958G>A, NM_000454.4:c.73-1211G>A
                            20.

                            rs4816407 [Homo sapiens]
                              TTAAACAGAACATTTTGTTAAGTTT[A/G]AAACCTGGGATGGACTTAAGTATTC
                              Chromosome:
                              21:31667716
                              Gene:
                              SOD1 (GeneView)
                              Functional Consequence:
                              intron variant
                              Validated:
                              by 1000G,by cluster,by frequency
                              Global MAF:
                              G=0.2756/1380
                              HGVS:
                              CM000683.2:g.31667716A>G, NC_000021.8:g.33040029A>G, NC_000021.9:g.31667716A>G, NG_008689.1:g.13095A>G, NM_000454.4:c.357+341A>G

                              Display Settings:

                              Format
                              Items per page
                              Sort by

                              Send to:

                              Choose Destination

                              Supplemental Content

                              Find related data

                              Recent activity

                              Your browsing activity is empty.

                              Activity recording is turned off.

                              Turn recording back on

                              See more...
                              Support Center