Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 8

1.

rs16892645 [Homo sapiens]
    ACATGATTTCAGAGTAGACCAAGAA[C/T]GCTTCTGGCTCCTGGAGTCACTAGA
    Chromosome:
    4:15936769
    Gene:
    FGFBP1 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by cluster,by frequency
    Global MAF:
    T=0.1192/597
    HGVS:
    CM000666.2:g.15936769C>T, NC_000004.11:g.15938392C>T, NC_000004.12:g.15936769C>T, NM_005130.4:c.-20-117G>A
    2.

    rs12503796 [Homo sapiens]
      TGACCCTCCTTGATGGGGAGAGGAC[A/C]CCAGCAGTGATGTCTATGGAGGAGT
      Chromosome:
      4:15938608
      Gene:
      FGFBP1 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      A=0.3750/1878
      HGVS:
      CM000666.2:g.15938608C>A, NC_000004.11:g.15940231C>A, NC_000004.12:g.15938608C>A, NM_005130.4:c.-242+79G>T
      3.

      rs2531174 [Homo sapiens]
        GTCCTCTCCCCATCAAGGAGGGTCA[C/T]TGTGAGGCTGAGTTGTCCTCCTATC
        Chromosome:
        4:15938582
        Gene:
        FGFBP1 (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by 1000G,by cluster,by frequency,by hapmap,by submitter
        Global MAF:
        G=0.0813/407
        HGVS:
        CM000666.2:g.15938582G>A, NC_000004.11:g.15940205G>A, NC_000004.12:g.15938582G>A, NM_005130.4:c.-242+105C>T
        4.

        rs2246196 [Homo sapiens]
          TTTATTTTTAGAAAATTTTAATTAG[C/G/T]TGCCAACCAATTTCATATAAACACA
          Chromosome:
          4:15939760
          Gene:
          FGFBP1 (GeneView)
          Functional Consequence:
          upstream variant 2KB
          Validated:
          by 1000G,by cluster,by frequency,by hapmap
          Global MAF:
          G=0.0735/368
          HGVS:
          CM000666.2:g.15939760G>A, CM000666.2:g.15939760G>C, NC_000004.11:g.15941383G>C, NC_000004.12:g.15939760G>A, NC_000004.12:g.15939760G>C, NM_005130.4:c.-1315C>G, NM_005130.4:c.-1315C>T
          5.

          rs2245964 [Homo sapiens]
            CACAGCTGCAGCCTGCAATTCACTC[A/C/G]CACTGCCTGGGATTGCACTGGATCC
            Chromosome:
            4:15938292
            Gene:
            FGFBP1 (GeneView)
            Functional Consequence:
            utr variant 5 prime
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
            Global MAF:
            C=0.2332/1168
            HGVS:
            CM000666.2:g.15938292C>G, CM000666.2:g.15938292C>T, NC_000004.11:g.15939915C>G, NC_000004.12:g.15938292C>G, NC_000004.12:g.15938292C>T, NM_005130.4:c.-62G>A, NM_005130.4:c.-62G>C
            6.

            rs2072313 [Homo sapiens]
              AGATGTCCCCCAGGGAGCACATCAA[A/G]GGCAAAGAGACCACCCCCTCTAGCC
              Chromosome:
              4:15936108
              Gene:
              FGFBP1 (GeneView)
              Functional Consequence:
              synonymous codon
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
              Global MAF:
              T=0.0851/426
              HGVS:
              CM000666.2:g.15936108T>C, NC_000004.11:g.15937731T>C, NC_000004.12:g.15936108T>C, NM_005130.4:c.525A>G, NP_005121.1:p.Lys175
              7.

              rs732245 [Homo sapiens]
                AAGGATTCCAGAAAGAGATAACTTG[A/C/T]GAAGGGTGGGGAACTGGAAGTTCCT
                Chromosome:
                4:15935462
                Gene:
                FGFBP1 (GeneView)
                Functional Consequence:
                downstream variant 500B
                Validated:
                by 1000G,by 2hit 2allele,by cluster,by frequency
                Global MAF:
                T=0.3722/1864
                HGVS:
                CM000666.2:g.15935462C>A, CM000666.2:g.15935462C>T, NC_000004.11:g.15937085C>T, NC_000004.12:g.15935462C>A, NC_000004.12:g.15935462C>T, NM_005130.4:c.*466G>A, NM_005130.4:c.*466G>T
                8.

                rs732244 [Homo sapiens]
                  GTGTTTATTGAAGTATAATAACTAG[A/G]ATCCCTGTTTTCAGGTGGGACACCT
                  Chromosome:
                  4:15935377
                  Gene:
                  FGFBP1 (GeneView)
                  Functional Consequence:
                  downstream variant 500B
                  Validated:
                  by 1000G,by 2hit 2allele,by cluster,by frequency
                  Global MAF:
                  T=0.3722/1864
                  HGVS:
                  CM000666.2:g.15935377C>T, NC_000004.11:g.15937000C>T, NC_000004.12:g.15935377C>T, NM_005130.4:c.*551G>A

                  Display Settings:

                  Format
                  Items per page
                  Sort by

                  Send to:

                  Choose Destination

                  Supplemental Content

                  Find related data

                  Recent activity

                  Your browsing activity is empty.

                  Activity recording is turned off.

                  Turn recording back on

                  See more...
                  Support Center