Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 1 to 20 of 22

1.

rs16969968 [Homo sapiens]
    TAGAAACACATTGGAAGCTGCGCTC[A/G]ATTCTATTCGCTACATTACAAGACA
    Chromosome:
    15:78590583
    Gene:
    CHRNA5 (GeneView)
    Functional Consequence:
    intron variant,missense,nc transcript variant
    Allele Origin:
    G(germline)/A(germline)
    Clinical significance:
    other
    Validated:
    no info
    Global MAF:
    A=0.1496/749
    HGVS:
    NC_000015.10:g.78590583G>A, NC_000015.9:g.78882925G>A, NG_023328.1:g.30064G>A, NM_000745.3:c.1192G>A, NM_001307945.1:c.458+734G>A, NP_000736.2:p.Asp398Asn, XM_005254142.1:c.707+485G>A, XM_005254142.3:c.707+485G>A, XM_017021881.1:c.713+479G>A, XR_001751067.1:n.1391G>A
    3.

    rs12914385 [Homo sapiens]
      ACACAAGTAACTGAATTAACACACA[C/T]GCAGATAACAGCAACTACAAAAATA
      Chromosome:
      15:78606381
      Gene:
      CHRNA3 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by cluster,by frequency,by hapmap
      Global MAF:
      T=0.2540/1272
      HGVS:
      NC_000015.10:g.78606381C>T, NC_000015.9:g.78898723C>T, NG_016143.1:g.19915G>A, NM_000743.4:c.378-4117G>A, NM_001166694.1:c.378-4117G>A, NR_046313.1:n.879-4117G>A, XM_006720382.2:c.177-4117G>A
      4.

      rs9788682 [Homo sapiens]
        TTCGCCCAGGTTGGAGTGAAGTGAC[A/G]CAGTCTCATCTCACTGCAACCTCCA
        Chromosome:
        15:78510244
        Gene:
        HYKK (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by 1000G,by cluster,by frequency,by hapmap
        Global MAF:
        A=0.2903/1454
        HGVS:
        NC_000015.10:g.78510244G>A, NC_000015.9:g.78802586G>A, NM_001013619.3:c.-6+2573G>A, NM_001083612.1:c.-6+2573G>A, XM_011521231.2:c.-6+2573G>A, XM_017021922.1:c.-6+2573G>A, XR_243078.1:n.90+2573G>A, XR_243078.4:n.90+2573G>A
        5.

        rs7872903 [Homo sapiens]
          ACTGGATTGAACGCTAGATGACTTT[C/T]AAAAAATTCAACCCTTTCGGAAGTG
          Chromosome:
          9:133619170
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
          Global MAF:
          C=0.2220/1112
          HGVS:
          NC_000009.11:g.136484292T>C, NC_000009.12:g.133619170T>C
          6.

          rs7163730 [Homo sapiens]
            ACAGGATGTTAAATAAACAAAAGAG[A/G]AGACTCCGgttcgagaccagcctgg
            Chromosome:
            15:78522339
            Gene:
            HYKK (GeneView)
            Functional Consequence:
            intron variant
            Validated:
            by 1000G,by cluster,by frequency,by hapmap
            Global MAF:
            G=0.3492/1749
            HGVS:
            NC_000015.10:g.78522339A>G, NC_000015.9:g.78814681A>G, NM_001013619.3:c.478-5041A>G, NM_001083612.1:c.478-5041A>G, XM_011521231.2:c.481+3748A>G, XM_017021922.1:c.478-5041A>G, XR_243078.1:n.758+3566A>G, XR_243078.4:n.758+3566A>G
            8.

            rs4923460 [Homo sapiens]
              TTTCCCGCCTCATCTAAGCACACTT[G/T]TTCTTTCTAATGCTCCCTGACTGTA
              Chromosome:
              11:27635242
              Gene:
              BDNF-AS (GeneView) LINC00678 (GeneView)
              Functional Consequence:
              intron variant,upstream variant 2KB
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
              Global MAF:
              T=0.2540/1272
              HGVS:
              NC_000011.10:g.27635242G>T, NC_000011.9:g.27656789G>T, NR_002832.2:n.214-4603G>T, NR_033312.1:n.145-4603G>T, NR_033313.1:n.145-4603G>T, NR_033314.1:n.214-4603G>T, NR_033315.1:n.145-4603G>T, NR_102708.1:n.-615C>A, XR_242807.1:n.63-4603G>T, XR_242808.1:n.63-4603G>T, XR_242809.1:n.63-4603G>T
              9.

              rs4923457 [Homo sapiens]
                CTTGTTCTGTCAAAGCTCCCTGTGA[A/T]CTATTTTTGCTGGGTACCACCATCT
                Chromosome:
                11:27627033
                Gene:
                BDNF-AS (GeneView) LINC00678 (GeneView)
                Functional Consequence:
                intron variant
                Validated:
                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                Global MAF:
                T=0.2524/1264
                HGVS:
                NC_000011.10:g.27627033A>T, NC_000011.9:g.27648580A>T, NR_002832.2:n.214-12812A>T, NR_033312.1:n.145-12812A>T, NR_033313.1:n.145-12812A>T, NR_033314.1:n.214-12812A>T, NR_033315.1:n.145-12812A>T, NR_102708.1:n.298-2888T>A, XR_242807.1:n.63-12812A>T, XR_242808.1:n.63-12812A>T, XR_242809.1:n.63-12812A>T
                10.

                rs4074134 [Homo sapiens]
                  CTTTCCAAGGCATTGCTGCCTCCCC[A/G]CAAGAAGACTCCCAGAGAAGGTCAT
                  Chromosome:
                  11:27625738
                  Gene:
                  BDNF-AS (GeneView) LINC00678 (GeneView)
                  Functional Consequence:
                  intron variant
                  Validated:
                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                  Global MAF:
                  T=0.2522/1263
                  HGVS:
                  NC_000011.10:g.27625738C>T, NC_000011.9:g.27647285C>T, NR_002832.2:n.214-14107C>T, NR_033312.1:n.145-14107C>T, NR_033313.1:n.145-14107C>T, NR_033314.1:n.214-14107C>T, NR_033315.1:n.145-14107C>T, NR_102708.1:n.298-1593G>A, XR_242807.1:n.63-14107C>T, XR_242808.1:n.63-14107C>T, XR_242809.1:n.63-14107C>T
                  11.

                  rs3733829 [Homo sapiens]
                    GAAACAGTGAGTTACTGACTAGAGA[C/T]GGGCAAGACCTCCCCAATTAGGAAT
                    Chromosome:
                    19:40804666
                    Gene:
                    EGLN2 (GeneView) RAB4B-EGLN2 (GeneView)
                    Functional Consequence:
                    intron variant
                    Validated:
                    by 1000G,by cluster,by frequency,by hapmap
                    Global MAF:
                    G=0.3007/1506
                    HGVS:
                    NC_000019.10:g.40804666A>G, NC_000019.9:g.41310571A>G, NM_053046.3:c.844-1889A>G, NM_080732.3:c.844-1889A>G, NR_037791.1:n.1892-1889A>G, XM_005258469.1:c.844-1889A>G, XM_005258470.1:c.844-1889A>G, XM_005258471.1:c.844-1889A>G
                    12.

                    rs3025343 [Homo sapiens]
                      CAGTTACTAGATTAACCTTTGTTTG[A/G]TCGTTGAATTGTTTCCTCTTCTTAG
                      Chromosome:
                      9:133613233
                      Validated:
                      by 1000G,by cluster,by frequency,by hapmap
                      Global MAF:
                      A=0.0349/175
                      HGVS:
                      NC_000009.11:g.136478355G>A, NC_000009.12:g.133613233G>A
                      13.

                      rs2806464 [Homo sapiens]
                        tgggattacaggcacatgccaccag[A/G]tctgtctaatttttgtatttttagt
                        Chromosome:
                        1:232066677
                        Gene:
                        LOC105373171 (GeneView)
                        Functional Consequence:
                        intron variant
                        Validated:
                        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                        Global MAF:
                        T=0.3237/1621
                        HGVS:
                        NC_000001.10:g.232202423T>C, NC_000001.11:g.232066677T>C, XR_949271.2:n.2762+5088T>C
                        14.

                        rs1611115 [Homo sapiens]
                        • Suspected
                        AAGGCAGCTGCCCTCAGTCTACTTG[C/T]GGGAGAGGACAGGAGGGAGAGGTGC
                        Chromosome:
                        9:133635393
                        Gene:
                        DBH (GeneView)
                        Functional Consequence:
                        upstream variant 2KB
                        Clinical significance:
                        Benign
                        Validated:
                        no info
                        Global MAF:
                        T=0.2127/1065
                        HGVS:
                        NC_000009.11:g.136500515T>C, NC_000009.12:g.133635393T>C, NG_008645.1:g.4031T>C, NM_000787.3:c.-979T>C
                        15.

                        rs1329650 [Homo sapiens]
                          GAAGAGATGCATAAAGGGTTCAGCA[A/C]GGTACCTGCCCAGTAAGGGGTAGTT
                          Chromosome:
                          10:91588363
                          Gene:
                          HECTD2-AS1 (GeneView)
                          Functional Consequence:
                          intron variant
                          Validated:
                          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                          Global MAF:
                          T=0.3968/1987
                          HGVS:
                          NC_000010.10:g.93348120G>T, NC_000010.11:g.91588363G>T, NR_024467.1:n.110+22988C>A
                          16.

                          rs1304100 [Homo sapiens]
                            CTGCCACCCAACCATGTTGGGCTCC[C/T]AATGCCTCTATGTCAATAAGCAAAG
                            Chromosome:
                            11:27550056
                            Gene:
                            BDNF-AS (GeneView)
                            Functional Consequence:
                            intron variant
                            Validated:
                            by 1000G,by cluster,by frequency,by hapmap
                            Global MAF:
                            G=0.2877/1441
                            HGVS:
                            NC_000011.10:g.27550056A>G, NC_000011.9:g.27571603A>G, NR_002832.2:n.144+9940A>G, NR_033312.1:n.144+9940A>G, NR_033313.1:n.144+9940A>G, NR_033314.1:n.144+9940A>G, NR_033315.1:n.144+9940A>G, XR_242807.1:n.62+43158A>G, XR_242808.1:n.62+43158A>G, XR_242809.1:n.62+43158A>G
                            17.

                            rs1051730 [Homo sapiens]
                              GGGCCATCATCAAAGCCCCAGGCTA[C/T]AAACACGACATCAAGTACAACTGCT
                              Chromosome:
                              15:78601997
                              Gene:
                              CHRNA3 (GeneView)
                              Functional Consequence:
                              nc transcript variant,synonymous codon
                              Allele Origin:
                              T(germline)/C(germline)
                              Clinical significance:
                              drug-response
                              Validated:
                              no info
                              Global MAF:
                              A=0.1681/842
                              HGVS:
                              NC_000015.10:g.78601997G>A, NC_000015.9:g.78894339G>A, NG_016143.1:g.24299C>T, NM_000743.4:c.645C>T, NM_001166694.1:c.645C>T, NP_000734.2:p.Tyr215, NP_001160166.1:p.Tyr215, NR_046313.1:n.1146C>T, XM_006720382.2:c.444C>T, XP_006720445.1:p.Tyr148
                              18.

                              rs1028936 [Homo sapiens]
                                tatctcatttaaccctcaacacaac[A/C]ctggggaaagtactattattatccc
                                Chromosome:
                                10:91590040
                                Gene:
                                HECTD2-AS1 (GeneView)
                                Functional Consequence:
                                intron variant
                                Validated:
                                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                Global MAF:
                                C=0.3145/1575
                                HGVS:
                                NC_000010.10:g.93349797A>C, NC_000010.11:g.91590040A>C, NR_024467.1:n.110+21311T>G
                                19.

                                rs1013442 [Homo sapiens]
                                  CTCACTGAAAATGAGATACAGCAAC[A/T]TCCTACAACTTCATAGTATCCATTC
                                  Chromosome:
                                  11:27557399
                                  Gene:
                                  BDNF-AS (GeneView)
                                  Functional Consequence:
                                  intron variant
                                  Validated:
                                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                                  Global MAF:
                                  T=0.1803/903
                                  HGVS:
                                  NC_000011.10:g.27557399A>T, NC_000011.9:g.27578946A>T, NR_002832.2:n.144+17283A>T, NR_033312.1:n.144+17283A>T, NR_033313.1:n.144+17283A>T, NR_033314.1:n.144+17283A>T, NR_033315.1:n.144+17283A>T, XR_242807.1:n.62+50501A>T, XR_242808.1:n.62+50501A>T, XR_242809.1:n.62+50501A>T
                                  20.

                                  rs879048 [Homo sapiens]
                                    GGAACTTGCACAGGGATTGGCACAT[A/C]ACAGATAATCAATCAATGATGAATT
                                    Chromosome:
                                    11:27617387
                                    Gene:
                                    BDNF-AS (GeneView) LINC00678 (GeneView)
                                    Functional Consequence:
                                    downstream variant 500B,intron variant
                                    Validated:
                                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                    Global MAF:
                                    C=0.3249/1627
                                    HGVS:
                                    NC_000011.10:g.27617387C>A, NC_000011.9:g.27638934C>A, NR_002832.2:n.214-22458C>A, NR_033312.1:n.145-22458C>A, NR_033313.1:n.145-22458C>A, NR_033314.1:n.214-22458C>A, NR_033315.1:n.145-22458C>A, NR_102708.1:n.1201G>T, XR_242807.1:n.63-22458C>A, XR_242808.1:n.63-22458C>A, XR_242809.1:n.63-22458C>A

                                    Display Settings:

                                    Format
                                    Items per page
                                    Sort by

                                    Send to:

                                    Choose Destination

                                    Supplemental Content

                                    Find related data

                                    Recent activity

                                    Your browsing activity is empty.

                                    Activity recording is turned off.

                                    Turn recording back on

                                    See more...
                                    Support Center