Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 1 to 20 of 52

1.

rs34518860 [Homo sapiens]
    GGAACCAATCTCCTGGGGGTGCAGA[A/G]CCACAGTCAAGTATGAGAAACAAAG
    Chromosome:
    6:32626326
    Gene:
    LOC107987449 (GeneView) LOC107987459 (GeneView)
    Functional Consequence:
    upstream variant 2KB
    Validated:
    by 1000G,by cluster,by frequency
    Global MAF:
    A=0.1002/502
    HGVS:
    NC_000006.11:g.32594103G>A, NC_000006.12:g.32626326G>A, NT_113891.3:g.4044278G>A, NT_167245.1:g.3875828G>A, NT_167245.2:g.3870243G>A, NT_167246.1:g.4050261G>A, NT_167246.2:g.4044641G>A, NT_167247.1:g.3932976G>A, NT_167248.2:g.3825248G>A, NT_167249.1:g.4027558G>A, XR_001756739.1:n.-1816G>A, XR_001756781.1:n.-1816G>A
    2.

    rs13091753 [Homo sapiens]
      GCAGTCTATAATAATCAAGGACTTA[C/G/T]AAGAAACCTGCTAAGGAGCCCGTTT
      Chromosome:
      3:188396801
      Gene:
      LPP (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by cluster,by frequency,by hapmap
      Global MAF:
      T=0.3994/2000
      HGVS:
      NC_000003.11:g.188114589G>T, NC_000003.12:g.188396801G>C, NC_000003.12:g.188396801G>T, NG_016932.2:g.247927G>C, NG_016932.2:g.247927G>T, NM_001167671.2:c.-9-9311G>C, NM_001167671.2:c.-9-9311G>T, NM_001167672.2:c.-9-9311G>C, NM_001167672.2:c.-9-9311G>T, NM_005578.4:c.-9-9311G>C, NM_005578.4:c.-9-9311G>T, XM_005247444.1:c.82-9311G>T, XM_005247445.1:c.-9-9311G>T, XM_005247446.1:c.-9-9311G>T, XM_005247446.4:c.-9-9311G>C, XM_005247446.4:c.-9-9311G>T, XM_005247447.1:c.-9-9311G>T, XM_005247448.1:c.-9-9311G>T, XM_005247449.1:c.-9-9311G>T, XM_005247450.1:c.-9-9311G>T, XM_005247450.4:c.-9-9311G>C, XM_005247450.4:c.-9-9311G>T, XM_005247451.1:c.-9-9311G>T, XM_005247451.4:c.-9-9311G>C, XM_005247451.4:c.-9-9311G>T, XM_005247452.1:c.-9-9311G>T, XM_005247453.1:c.-9-9311G>T, XM_005247453.2:c.-9-9311G>C, XM_005247453.2:c.-9-9311G>T, XM_011512820.2:c.-9-9311G>C, XM_011512820.2:c.-9-9311G>T, XM_011512823.2:c.67-9311G>C, XM_011512823.2:c.67-9311G>T, XM_011512827.2:c.-9-9311G>C, XM_011512827.2:c.-9-9311G>T, XM_011512828.2:c.-9-9311G>C, XM_011512828.2:c.-9-9311G>T, XM_011512831.2:c.-9-9311G>C, XM_011512831.2:c.-9-9311G>T, XM_011512833.2:c.-9-9311G>C, XM_011512833.2:c.-9-9311G>T, XM_011512834.2:c.-9-9311G>C, XM_011512834.2:c.-9-9311G>T, XM_017006377.1:c.-9-9311G>C, XM_017006377.1:c.-9-9311G>T, XM_017006378.1:c.-9-9311G>C, XM_017006378.1:c.-9-9311G>T, XM_017006379.1:c.-9-9311G>C, XM_017006379.1:c.-9-9311G>T, XM_017006380.1:c.-9-9311G>C, XM_017006380.1:c.-9-9311G>T, XM_017006381.1:c.-9-9311G>C, XM_017006381.1:c.-9-9311G>T, XR_001740144.1:n.181-9311G>C, XR_001740144.1:n.181-9311G>T
      4.

      rs12251307 [Homo sapiens]
        CGAAGTAGCTAACGTGTTGGAAGTC[C/T]CCATAAGGCACATGAGCTGCAGAGA
        Chromosome:
        10:6081532
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        T=0.2109/1056
        HGVS:
        NC_000010.10:g.6123495C>T, NC_000010.11:g.6081532C>T
        6.

        rs11203203 [Homo sapiens]
          AAGAGTTTTCTTCTTGAAACTCTAC[A/G]ATTAAACAAAAAGCCGTTGAACTGG
          Chromosome:
          21:42416077
          Gene:
          UBASH3A (GeneView)
          Functional Consequence:
          intron variant,utr variant 5 prime
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
          Global MAF:
          A=0.1979/991
          HGVS:
          NC_000021.8:g.43836186G>A, NC_000021.9:g.42416077G>A, NG_029750.1:g.17216G>A, NM_001001895.2:c.554-365G>A, NM_001243467.1:c.554-365G>A, NM_018961.3:c.668-365G>A, XM_006724013.3:c.611-365G>A, XM_011529605.2:c.668-365G>A, XM_011529606.2:c.263-365G>A, XM_011529607.2:c.263-365G>A, XM_011529609.1:c.668-365G>A, XM_011529610.2:c.-381G>A, XR_244316.1:n.638-365G>A
          7.

          rs11121194 [Homo sapiens]
            AAAGAAGATGGCCTAAAAGGAGGCA[C/T]ATGCTCTTGTTTTTCTCTCATGGAT
            Chromosome:
            1:8509847
            Gene:
            RERE (GeneView)
            Functional Consequence:
            intron variant
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
            Global MAF:
            C=0.4050/2028
            HGVS:
            NC_000001.10:g.8569906C>T, NC_000001.11:g.8509847C>T, NG_047035.1:g.312845G>A, NM_001042681.1:c.831-1172G>A, NM_012102.3:c.831-1172G>A, XM_005263464.1:c.831-1172G>A, XM_005263464.2:c.831-1172G>A, XM_005263465.1:c.705-1172G>A, XM_005263466.1:c.27-1172G>A, XM_011541510.1:c.705-1172G>A, XM_011541511.1:c.831-1172G>A, XM_017001358.1:c.831-1172G>A, XM_017001359.1:c.831-1172G>A
            8.

            rs11018528 [Homo sapiens]
              AAAAAATGAGAAGTTCTACGTGGCT[A/G]GAATATTGAGTTTGTAGTGGGAAAT
              Chromosome:
              11:89197209
              Gene:
              LOC107984363 (GeneView) TYR (GeneView)
              Functional Consequence:
              intron variant
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
              Global MAF:
              G=0.2005/1004
              HGVS:
              NC_000011.10:g.89197209A>G, NC_000011.9:g.88930377A>G, NG_008748.1:g.24338A>G, NM_000372.4:c.1036+5791A>G, XM_011542970.2:c.1036+5791A>G, XR_001748321.1:n.2717+74251T>C, XR_001748322.1:n.2732+74251T>C
              9.

              rs10830236 [Homo sapiens]
                CTAAAATAATCCTATTCATTTGTTC[C/T]TATGAACCTTAATATGTACACACAG
                Chromosome:
                11:89167648
                Gene:
                LOC107984363 (GeneView)
                Functional Consequence:
                intron variant
                Validated:
                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                Global MAF:
                T=0.2244/1124
                HGVS:
                NC_000011.10:g.89167648C>T, NC_000011.9:g.88900816C>T, XR_001748321.1:n.2718-54115G>A, XR_001748322.1:n.2733-54115G>A
                10.

                rs10765198 [Homo sapiens]
                  TAGAGAACTGTGGGTTACCACAGAA[C/T]ATTGTGTGGCATCTGAGCCATCCTC
                  Chromosome:
                  11:89236606
                  Gene:
                  LOC107984363 (GeneView) TYR (GeneView)
                  Functional Consequence:
                  intron variant
                  Validated:
                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                  Global MAF:
                  C=0.2843/1424
                  HGVS:
                  NC_000011.10:g.89236606T>C, NC_000011.9:g.88969774T>C, NG_008748.1:g.63735T>C, NM_000372.4:c.1184+8636T>C, XM_011542970.2:c.1184+8636T>C, XR_001748321.1:n.2717+34854A>G, XR_001748322.1:n.2732+34854A>G
                  14.

                  rs8192917 [Homo sapiens]
                    AAGAGGTGCGGTGGCTTCCTGATAC[A/G]AGACGACTTCGTGCTGACAGCTGCT
                    Chromosome:
                    14:24632954
                    Gene:
                    GZMB (GeneView) LOC107984667 (GeneView)
                    Functional Consequence:
                    missense,nc transcript variant,upstream variant 2KB
                    Validated:
                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                    Global MAF:
                    C=0.3193/1599
                    HGVS:
                    NC_000014.8:g.25102160C>T, NC_000014.9:g.24632954C>T, NG_028340.1:g.6273G>A, NM_001346011.1:c.128G>A, NM_004131.5:c.164G>A, NP_001332940.1:p.Arg43Gln, NP_004122.2:p.Arg55Gln, NR_144343.1:n.273G>A, XM_005267571.1:c.368G>A, XM_005267572.1:c.266G>A, XM_011536685.2:c.128G>A, XP_005267628.1:p.Arg123Gln, XP_005267629.1:p.Arg89Gln, XP_011534987.1:p.Arg43Gln, XR_001750665.1:n.-128C>T
                    16.

                    rs7099083 [Homo sapiens]
                      GGAGAGACCCCCTCCACCTCCTGCT[A/G]AGCAGGAGCCCAGGAGCCGCCCCCT
                      Chromosome:
                      10:6136273
                      Gene:
                      LOC101928080 (GeneView)
                      Functional Consequence:
                      intron variant
                      Validated:
                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                      Global MAF:
                      A=0.4159/2083
                      HGVS:
                      NC_000010.10:g.6178236G>A, NC_000010.11:g.6136273G>A, XR_242714.1:n.21+4745C>T, XR_930619.2:n.444+4745C>T, XR_930620.2:n.444+4745C>T
                      17.

                      rs7090530 [Homo sapiens]
                        AGGTCCCACAAATTACATTTTACTT[A/C]GCTCATGCACTCTTGGGTGCACCCT
                        Chromosome:
                        10:6068912
                        Validated:
                        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                        Global MAF:
                        C=0.3786/1896
                        HGVS:
                        NC_000010.10:g.6110875C>A, NC_000010.11:g.6068912C>A
                        19.

                        Display Settings:

                        Format
                        Items per page
                        Sort by

                        Send to:

                        Choose Destination

                        Supplemental Content

                        Find related data

                        Recent activity

                        Your browsing activity is empty.

                        Activity recording is turned off.

                        Turn recording back on

                        See more...
                        Support Center