Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 1 to 20 of 21

1.

rs61854782 [Homo sapiens]
    CTTCTGCAGCAGAGTTTGGTGTGGC[G/T]GGTTCGAGGAAGGCCTTTCAAGTCC
    Chromosome:
    10:68231992
    Gene:
    ATOH7 (GeneView)
    Functional Consequence:
    utr variant 5 prime
    Validated:
    by 1000G,by cluster,by frequency
    Global MAF:
    G=0.1360/681
    HGVS:
    CM000672.2:g.68231992T>G, NC_000010.10:g.69991749T>G, NC_000010.11:g.68231992T>G, NG_031934.1:g.5122A>C, NM_145178.3:c.-315A>C
    2.

    rs34888891 [Homo sapiens]
      TAGATCAGCTTTGTTGGTCCTCCAA[A/G]GTGTGTTTCCCAAATGTTGTCCTGA
      Chromosome:
      10:68242351
      Gene:
      LOC107984241 (GeneView)
      Functional Consequence:
      nc transcript variant
      Validated:
      by 1000G,by cluster,by frequency
      Global MAF:
      G=0.1312/657
      HGVS:
      CM000672.2:g.68242351A>G, NC_000010.10:g.70002108A>G, NC_000010.11:g.68242351A>G, XR_001747481.1:n.72T>C
      3.

      rs17231602 [Homo sapiens]
        AGCTGAGGAAACAGGGTTGGAGGGT[A/G]AACCCAAACATGGAGCACAGAGCAC
        Chromosome:
        10:68252532
        Validated:
        by 1000G,by cluster,by frequency
        Global MAF:
        A=0.1346/674
        HGVS:
        CM000672.2:g.68252532G>A, NC_000010.10:g.70012289G>A
        4.

        rs12571093 [Homo sapiens]
          ttttgtgtctggattatttcattta[A/G]cttgttttcaagatccgtccatgtt
          Chromosome:
          10:68259614
          Validated:
          by 1000G,by cluster,by frequency,by hapmap
          Global MAF:
          A=0.1446/724
          HGVS:
          CM000672.2:g.68259614G>A, NC_000010.10:g.70019371G>A
          5.

          rs10762217 [Homo sapiens]
            AGAGTGATGTATATTTGTCCCTCTG[C/G/T]AATAGTCTTAGTTTGTTTACAGTTT
            Chromosome:
            10:68309040
            Gene:
            PBLD (GeneView)
            Functional Consequence:
            intron variant
            Validated:
            by 1000G,by cluster,by frequency,by hapmap
            Global MAF:
            C=0.2606/1305
            HGVS:
            CM000672.2:g.68309040C>G, CM000672.2:g.68309040C>T, NC_000010.10:g.70068797C>T, NC_000010.11:g.68309040C>G, NC_000010.11:g.68309040C>T, NM_001033083.1:c.-59-2137G>A, NM_001033083.1:c.-59-2137G>C, NM_022129.3:c.-59-2137G>A, NM_022129.3:c.-59-2137G>C
            6.

            rs10762201 [Homo sapiens]
              AGCGTGAAAATGGACTAATACAAGC[A/G]GAAACATAGCTCCCTCTGCACTCAC
              Chromosome:
              10:68280354
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
              Global MAF:
              A=0.3902/1954
              HGVS:
              CM000672.2:g.68280354A>G, NC_000010.10:g.70040111A>G
              7.

              rs10733843 [Homo sapiens]
                AAAACTCTTCAAGGATATTACATGC[A/G]GACATGGGGCAAATGTATTAAGACT
                Chromosome:
                10:68304752
                Gene:
                PBLD (GeneView)
                Functional Consequence:
                intron variant
                Validated:
                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                Global MAF:
                A=0.2382/1193
                HGVS:
                CM000672.2:g.68304752A>G, NC_000010.10:g.70064509A>G, NC_000010.11:g.68304752A>G, NM_001033083.1:c.84+2009T>C, NM_022129.3:c.84+2009T>C
                8.

                rs7916697 [Homo sapiens]
                  AGGGAAGGAGCGCTTTTAGCGCAGT[A/G]GCTGTCGGAGAGTGCAGAATGAATC
                  Chromosome:
                  10:68232096
                  Gene:
                  ATOH7 (GeneView)
                  Functional Consequence:
                  utr variant 5 prime
                  Validated:
                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                  Global MAF:
                  A=0.4401/2204
                  HGVS:
                  CM000672.2:g.68232096A>G, NC_000010.10:g.69991853A>G, NC_000010.11:g.68232096A>G, NG_031934.1:g.5018T>C, NM_145178.3:c.-419T>C
                  9.

                  rs7896916 [Homo sapiens]
                    ATACATCTTTACACTCAGAAGTTTT[A/T]AAACTTGCTATTTTGAAATTAAAGA
                    Chromosome:
                    10:68243826
                    Gene:
                    LOC107984241 (GeneView)
                    Functional Consequence:
                    intron variant
                    Validated:
                    by 1000G,by cluster,by frequency
                    Global MAF:
                    A=0.0120/60
                    HGVS:
                    CM000672.2:g.68243826T>A, NC_000010.10:g.70003583T>A, NC_000010.11:g.68243826T>A, XR_001747481.1:n.36+298A>T
                    10.

                    rs7067601 [Homo sapiens]
                      CGTCTATTATAATTTTTATTGATTA[C/T]GAATTAGGAAAAGTGCTATCTTCGC
                      Chromosome:
                      10:68304213
                      Gene:
                      PBLD (GeneView)
                      Functional Consequence:
                      intron variant
                      Validated:
                      by 1000G,by cluster,by frequency,by hapmap
                      Global MAF:
                      C=0.2382/1193
                      HGVS:
                      CM000672.2:g.68304213C>T, NC_000010.10:g.70063970C>T, NC_000010.11:g.68304213C>T, NM_001033083.1:c.84+2548G>A, NM_022129.3:c.84+2548G>A
                      11.

                      rs6611365 [Homo sapiens]
                        TTCACAGGACTGCTGTGTTCCAGGC[A/G]AAGATGCCAGGGCATGCCACCAGGA
                        Chromosome:
                        X:47314877
                        Validated:
                        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                        Global MAF:
                        A=0.3356/1267
                        HGVS:
                        CM000685.2:g.47314877G>A, NC_000023.10:g.47174276G>A
                        12.

                        rs6480320 [Homo sapiens]
                          CACTTGCCCAAATTTAGGGGAAAAT[A/G]AGATGCTCAAGAGAAAGTCATTTTC
                          Chromosome:
                          10:68231911
                          Gene:
                          ATOH7 (GeneView)
                          Functional Consequence:
                          utr variant 5 prime
                          Validated:
                          by 1000G,by 2hit 2allele,by cluster,by frequency
                          Global MAF:
                          A=0.0713/357
                          HGVS:
                          CM000672.2:g.68231911G>A, NC_000010.10:g.69991668G>A, NC_000010.11:g.68231911G>A, NG_031934.1:g.5203C>T, NM_145178.3:c.-234C>T
                          14.

                          rs4517412 [Homo sapiens]
                            CTATCCACCAGGTTTTCCTGTGGTT[A/C/G/T]CTCTCATCCTGGTCAAATTTTGAAT
                            Chromosome:
                            10:68303779
                            Gene:
                            PBLD (GeneView)
                            Functional Consequence:
                            intron variant
                            Validated:
                            by 1000G,by 2hit 2allele,by cluster,by frequency
                            Global MAF:
                            A=0.2378/1191
                            HGVS:
                            CM000672.2:g.68303779A>C, CM000672.2:g.68303779A>G, CM000672.2:g.68303779A>T, NC_000010.10:g.70063536A>G, NC_000010.11:g.68303779A>C, NC_000010.11:g.68303779A>G, NC_000010.11:g.68303779A>T, NM_001033083.1:c.84+2982T>A, NM_001033083.1:c.84+2982T>C, NM_001033083.1:c.84+2982T>G, NM_022129.3:c.84+2982T>A, NM_022129.3:c.84+2982T>C, NM_022129.3:c.84+2982T>G
                            15.

                            rs3858145 [Homo sapiens]
                              GATCTGAGGTGCAAAGAGGAAGGCA[A/G]TTGTAATAATGGGAAATTGGACTAA
                              Chromosome:
                              10:68252081
                              Validated:
                              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                              Global MAF:
                              G=0.3574/1790
                              HGVS:
                              CM000672.2:g.68252081A>G, NC_000010.10:g.70011838A>G
                              16.

                              rs2241970 [Homo sapiens]
                                GATGAGCCTGGTCTCCACAGTTAGC[A/G]TGAGTCCCTTGAGAGCCGGGTAAGC
                                Chromosome:
                                10:68271310
                                Validated:
                                by 1000G,by cluster,by frequency,by submitter
                                Global MAF:
                                G=0.1448/725
                                HGVS:
                                CM000672.2:g.68271310A>G, NC_000010.10:g.70031067A>G
                                17.

                                rs1900004 [Homo sapiens]
                                  TGGGTACACCGTGAAGAATAAGGCC[A/G]TGTTCCTGCCATCAAAGCTCTCACA
                                  Chromosome:
                                  10:68241124
                                  Gene:
                                  LOC107984241 (GeneView)
                                  Functional Consequence:
                                  intron variant
                                  Validated:
                                  by 1000G,by 2hit 2allele,by cluster,by frequency,by submitter
                                  Global MAF:
                                  T=0.4191/2099
                                  HGVS:
                                  CM000672.2:g.68241124C>T, NC_000010.10:g.70000881C>T, NC_000010.11:g.68241124C>T, XR_001747481.1:n.103+1196G>A
                                  18.

                                  rs1192415 [Homo sapiens]
                                    AACGGATTAGGGCAGGAAGTTTTAC[A/G]TTCCTGTCGTATTTGCTGAAGGTGT
                                    Chromosome:
                                    1:91611540
                                    Validated:
                                    by 1000G,by 2hit 2allele,by cluster,by frequency,by submitter
                                    Global MAF:
                                    G=0.2157/1080
                                    HGVS:
                                    CM000663.2:g.91611540G>A, NC_000001.10:g.92077097G>A
                                    19.

                                    rs1192404 [Homo sapiens]
                                      atttttccctgaaagtggctggcaa[A/G]tgcaagggagtaagaaaaggtgaga
                                      Chromosome:
                                      1:91603410
                                      Validated:
                                      by 1000G,by 2hit 2allele,by cluster,by frequency
                                      Global MAF:
                                      G=0.2364/1184
                                      HGVS:
                                      CM000663.2:g.91603410A>G, NC_000001.10:g.92068967A>G
                                      20.

                                      rs690037 [Homo sapiens]
                                        GTTATTTGTCCACTTTCCTCCCTCC[A/C/G]TTGTGAGTTTCTTGGTCTGGGAATA
                                        Chromosome:
                                        3:16354161
                                        Gene:
                                        OXNAD1 (GeneView) RFTN1 (GeneView)
                                        Functional Consequence:
                                        intron variant
                                        Validated:
                                        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                                        Global MAF:
                                        T=0.4948/2478
                                        HGVS:
                                        CM000665.2:g.16354161C>G, CM000665.2:g.16354161C>T, NC_000003.11:g.16395668C>T, NC_000003.12:g.16354161C>G, NC_000003.12:g.16354161C>T, NM_015150.1:c.1146+3771G>A, NM_015150.1:c.1146+3771G>C, XR_001740365.1:n.1470-15518C>G, XR_001740365.1:n.1470-15518C>T

                                        Display Settings:

                                        Format
                                        Items per page
                                        Sort by

                                        Send to:

                                        Choose Destination

                                        Supplemental Content

                                        Find related data

                                        Recent activity

                                        Your browsing activity is empty.

                                        Activity recording is turned off.

                                        Turn recording back on

                                        See more...
                                        Support Center