Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 7

1.

rs16969968 [Homo sapiens]
    TAGAAACACATTGGAAGCTGCGCTC[A/G]ATTCTATTCGCTACATTACAAGACA
    Chromosome:
    15:78590583
    Gene:
    CHRNA5 (GeneView)
    Functional Consequence:
    intron variant,missense,nc transcript variant
    Allele Origin:
    G(germline)/A(germline)
    Clinical significance:
    other
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    A=0.1496/749
    HGVS:
    NC_000015.10:g.78590583G>A, NC_000015.9:g.78882925G>A, NG_023328.1:g.30064G>A, NM_000745.3:c.1192G>A, NM_001307945.1:c.458+734G>A, NP_000736.2:p.Asp398Asn, XM_005254142.1:c.707+485G>A, XM_005254142.3:c.707+485G>A, XM_017021881.1:c.713+479G>A, XR_001751067.1:n.1391G>A
    2.

    rs8034191 [Homo sapiens]
      CCCAATGTGGTATAAGTTTTCTGTT[C/T]AGAAAGGCCCTGACAGATAGTAACT
      Chromosome:
      15:78513681
      Gene:
      HYKK (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      C=0.1889/946
      HGVS:
      NC_000015.10:g.78513681T>C, NC_000015.9:g.78806023T>C, NM_001013619.3:c.337+256T>C, NM_001083612.1:c.337+256T>C, XM_011521231.2:c.337+256T>C, XM_017021922.1:c.337+256T>C, XR_243078.1:n.432+256T>C, XR_243078.4:n.432+256T>C
      3.

      rs1051730 [Homo sapiens]
        GGGCCATCATCAAAGCCCCAGGCTA[C/T]AAACACGACATCAAGTACAACTGCT
        Chromosome:
        15:78601997
        Gene:
        CHRNA3 (GeneView)
        Functional Consequence:
        nc transcript variant,synonymous codon
        Allele Origin:
        T(germline)/C(germline)
        Clinical significance:
        drug-response
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
        Global MAF:
        A=0.1681/842
        HGVS:
        NC_000015.10:g.78601997G>A, NC_000015.9:g.78894339G>A, NG_016143.1:g.24299C>T, NM_000743.4:c.645C>T, NM_001166694.1:c.645C>T, NP_000734.2:p.Tyr215, NP_001160166.1:p.Tyr215, NR_046313.1:n.1146C>T, XM_006720382.2:c.444C>T, XP_006720445.1:p.Tyr148
        4.

        rs588765 [Homo sapiens]
          AGCTACTAGTGTCACAACAGTGGTT[C/T]GCAAGAAGGGTCAGTTTTGCTCCCC
          Chromosome:
          15:78573083
          Gene:
          CHRNA5 (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 1000G,by cluster,by frequency,by hapmap
          Global MAF:
          T=0.2756/1380
          HGVS:
          NC_000015.10:g.78573083T>C, NC_000015.9:g.78865425T>C, NG_023328.1:g.12564T>C, NM_000745.3:c.106+7258T>C, NM_001307945.1:c.106+7258T>C, XM_005254142.1:c.106+7258T>C, XM_005254142.3:c.106+7258T>C, XM_017021881.1:c.106+7258T>C, XR_001751067.1:n.305+7258T>C
          5.

          rs481134 [Homo sapiens]
            GAGCAATTTTCCTTGATTAAAACAC[C/T]AGAGCTGGCTGGGCACGGTGGCTCA
            Chromosome:
            15:78585221
            Gene:
            CHRNA5 (GeneView)
            Functional Consequence:
            intron variant
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
            Global MAF:
            A=0.2754/1379
            HGVS:
            NC_000015.10:g.78585221A>G, NC_000015.9:g.78877563A>G, NG_023328.1:g.24702A>G, NM_000745.3:c.259-1424A>G, NM_001307945.1:c.259-1424A>G, XM_005254142.1:c.259-1424A>G, XM_005254142.3:c.259-1424A>G, XM_017021881.1:c.259-1424A>G, XR_001751067.1:n.458-1424A>G
            6.

            rs330924 [Homo sapiens]
              TTTTCTTTCTTCTCTTCCCTTTCCA[C/G]GGTTCTAGCCTGTTCATCTAGCCCC
              Chromosome:
              8:9141677
              Gene:
              PPP1R3B (GeneView)
              Functional Consequence:
              intron variant,splice acceptor variant
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
              Global MAF:
              G=0.4892/2450
              HGVS:
              NC_000008.10:g.8999187G>C, NC_000008.11:g.9141677G>C, NG_028089.1:g.14966C>G, NM_001201329.1:c.-17-9C>G, NM_024607.3:c.-17-9C>G, XM_006716253.3:c.-25-1C>G, XM_017013835.1:c.-25-1C>G
              7.

              rs105730 [Homo sapiens]
                aaaaccaaacaccgcatattctcac[A/T]cataggtgggaattgaacaatgaga
                Chromosome:
                12:15477280
                Gene:
                PTPRO (GeneView)
                Functional Consequence:
                intron variant
                Validated:
                by cluster
                HGVS:
                NC_000012.11:g.15630214A>T, NC_000012.12:g.15477280A>T, NG_031857.1:g.160024A>T, NM_002848.3:c.76-6694A>T, NM_030667.2:c.76-6694A>T, XM_017019725.1:c.76-6694A>T, XR_931316.2:n.518-6694A>T

                Display Settings:

                Format
                Items per page
                Sort by

                Send to:

                Choose Destination

                Supplemental Content

                Find related data

                Recent activity

                Your browsing activity is empty.

                Activity recording is turned off.

                Turn recording back on

                See more...
                Support Center