Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 13

2.

rs13397985 [Homo sapiens]
    TTTATTCTTCTGTTCTGGTATTTTT[G/T]ACATATCTGGTCAGAGAAGCCTGGA
    Chromosome:
    2:230226508
    Gene:
    SP110 (GeneView) SP140 (GeneView)
    Functional Consequence:
    intron variant,upstream variant 2KB
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    G=0.1064/533
    HGVS:
    NC_000002.11:g.231091223T>G, NC_000002.12:g.230226508T>G, NG_051286.1:g.28585T>G, NM_001005176.2:c.59+605T>G, NM_001185015.1:c.-1037A>C, NM_001278451.1:c.59+605T>G, NM_001278452.1:c.59+605T>G, NM_001278453.1:c.59+605T>G, NM_007237.4:c.59+605T>G, XM_005246252.1:c.59+605T>G, XM_005246252.2:c.59+605T>G, XM_005246253.1:c.59+605T>G, XM_005246253.2:c.59+605T>G, XM_005246254.1:c.59+605T>G, XM_005246254.2:c.59+605T>G, XM_005246255.1:c.59+605T>G, XM_005246255.2:c.59+605T>G, XM_005246256.1:c.59+605T>G, XM_005246256.2:c.59+605T>G, XM_005246257.1:c.59+605T>G, XM_005246258.1:c.59+605T>G, XM_005246525.1:c.-1037A>C, XM_005246525.3:c.-1037A>C, XM_006712223.3:c.59+605T>G, XM_006712487.3:c.-1037A>C, XM_006712489.3:c.-1037A>C, XM_011510515.1:c.59+605T>G, XM_011510516.1:c.59+605T>G, XM_011510517.2:c.-1-10575T>G, XM_011510518.2:c.-140+605T>G, XM_011510519.1:c.59+605T>G, XM_011510520.1:c.59+605T>G, XM_011511088.2:c.-1037A>C, XM_011511090.2:c.-1037A>C, XM_011511091.2:c.-1037A>C, XM_017003239.1:c.59+605T>G, XM_017003240.1:c.59+605T>G, XM_017003241.1:c.59+605T>G, XM_017003242.1:c.59+605T>G, XM_017003243.1:c.59+605T>G, XM_017003244.1:c.-140+605T>G, XM_017003245.1:c.59+605T>G, XM_017003246.1:c.59+605T>G, XM_017003247.1:c.59+605T>G, XM_017003248.1:c.59+605T>G, XM_017003249.1:c.59+605T>G, XM_017003250.1:c.59+605T>G, XM_017003251.1:c.-140+605T>G, XM_017003252.1:c.59+605T>G, XM_017003968.1:c.-1216A>C, XM_017003969.1:c.-1037A>C, XR_001738595.1:n.138+605T>G, XR_001738596.1:n.138+605T>G, XR_241278.1:n.138+605T>G
    4.

    rs11083846 [Homo sapiens]
      AGTTCGGTGGTGCTACGGCTCTGTC[A/G]TTGGCAAGAATGGAGGGGACACATC
      Chromosome:
      19:46704397
      Gene:
      PRKD2 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      A=0.0956/479
      HGVS:
      NC_000019.10:g.46704397G>A, NC_000019.9:g.47207654G>A, NM_001079880.1:c.667-6C>T, NM_001079881.1:c.667-6C>T, NM_001079882.1:c.196-6C>T, NM_016457.4:c.667-6C>T, XM_005258715.1:c.667-6C>T, XM_005258716.1:c.196-6C>T, XM_005258716.2:c.196-6C>T
      5.

      rs11072110 [Homo sapiens]
        ATCTGTCAGTAGGAATTATTGGTTC[C/T]AGCTCCAAAAATACATTCTGAATCT
        Chromosome:
        15:69695543
        Gene:
        PCAT29 (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        C=0.3474/1740
        HGVS:
        NC_000015.10:g.69695543C>T, NC_000015.9:g.69987882C>T, NR_126437.1:n.611-124C>T, NR_126438.1:n.378-124C>T
        6.

        rs10220831 [Homo sapiens]
          TCCCCTCACTGACCAGGGTTGTGAT[C/T]GACGACAATAGAATTACCCTACACT
          Chromosome:
          15:69699775
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
          Global MAF:
          T=0.3259/1632
          HGVS:
          NC_000015.10:g.69699775T>C, NC_000015.9:g.69992114T>C
          7.

          rs9378805 [Homo sapiens]
            GTGGGCAGGACTGAAGGATAACTCC[A/C]TGGTAACCGGCGTGGATCGATGACT
            Chromosome:
            6:417727
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
            Global MAF:
            C=0.3143/1574
            HGVS:
            NC_000006.11:g.417727A>C, NC_000006.12:g.417727A>C
            8.

            rs7176508 [Homo sapiens]
              AGAATTGGTCAAGGGACATCCGGGT[A/G]AGCTCGCCCCCAAGGTGCACCGTAG
              Chromosome:
              15:69726651
              Validated:
              by 1000G,by cluster,by frequency,by hapmap
              Global MAF:
              A=0.3131/1568
              HGVS:
              NC_000015.10:g.69726651A>G, NC_000015.9:g.70018990A>G
              9.

              rs4802322 [Homo sapiens]
                CCAGGCCCAACTTAGACACTTACTC[A/G]CTACATGATCTTACGCAGGTCATCA
                Chromosome:
                19:46739735
                Gene:
                STRN4 (GeneView)
                Functional Consequence:
                intron variant,upstream variant 2KB
                Validated:
                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                Global MAF:
                A=0.2292/1148
                HGVS:
                NC_000019.10:g.46739735G>A, NC_000019.9:g.47242992G>A, NM_001039877.1:c.283-847C>T, NM_013403.2:c.283-847C>T, XM_005258826.1:c.-75-847C>T, XM_006723171.2:c.283-847C>T, XM_006723172.2:c.283-847C>T, XM_006723174.2:c.-76+429C>T, XM_011526878.1:c.283-847C>T, XM_017026716.1:c.-501C>T, XM_017026717.1:c.-501C>T, XM_017026719.1:c.283-847C>T
                10.

                rs4777184 [Homo sapiens]
                  TCCAAACTCTCCTATATCCAGTCAA[C/T]CTCTTGTGCCATCTCCCTTTGGTTC
                  Chromosome:
                  15:69714984
                  Validated:
                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                  Global MAF:
                  T=0.3263/1634
                  HGVS:
                  NC_000015.10:g.69714984T>C, NC_000015.9:g.70007323T>C
                  11.

                  rs3902140 [Homo sapiens]
                    GTGGGGTGCAGCACTCAAGAACATG[C/G]GCTTTGAGCTAAGACTGCTTGACTT
                    Chromosome:
                    15:69712013
                    Validated:
                    by 1000G,by cluster,by frequency,by hapmap
                    Global MAF:
                    G=0.3295/1650
                    HGVS:
                    NC_000015.10:g.69712013G>C, NC_000015.9:g.70004352G>C
                    12.

                    rs872071 [Homo sapiens]
                      AAGAAATGTAGCTGAAGTAGAGGGG[A/G]CGTGAGAGAAGGGCCAGGCCGGCAG
                      Chromosome:
                      6:411064
                      Gene:
                      IRF4 (GeneView)
                      Functional Consequence:
                      nc transcript variant,utr variant 3 prime
                      Validated:
                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                      Global MAF:
                      G=0.3113/1559
                      HGVS:
                      NC_000006.11:g.411064A>G, NC_000006.12:g.411064A>G, NG_027728.1:g.24326A>G, NM_001195286.1:c.*3466A>G, NM_002460.3:c.*3466A>G, NR_046000.2:n.5079A>G, XM_006715090.2:c.*3466A>G

                      Display Settings:

                      Format
                      Items per page
                      Sort by

                      Send to:

                      Choose Destination

                      Supplemental Content

                      Find related data

                      Recent activity

                      Your browsing activity is empty.

                      Activity recording is turned off.

                      Turn recording back on

                      See more...
                      Support Center