Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 1 to 20 of 62

7.

rs12987286 [Homo sapiens]
    CTTGAGTTCAGGTTTTCTTTGGCTT[G/T]TACAGGGTCTCGTCTGTCAGTTGAT
    Chromosome:
    2:147905999
    Gene:
    ACVR2A (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    T=0.2718/1361
    HGVS:
    NC_000002.11:g.148663568G>T, NC_000002.12:g.147905999G>T, NM_001278579.1:c.528+6101G>T, NM_001278580.1:c.204+6101G>T, NM_001616.4:c.528+6101G>T, XM_005263843.1:c.528+6101G>T
    8.
    10.

    rs12473543 [Homo sapiens]
      AGGAATAGTTTGGGAAGCTAAAGAT[G/T]TAAAGTACAGAATAGATTGAGGGGT
      Chromosome:
      2:25164312
      Gene:
      POMC (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by cluster,by frequency,by hapmap
      Global MAF:
      G=0.3454/1730
      HGVS:
      NC_000002.11:g.25387181T>G, NC_000002.12:g.25164312T>G, NG_008997.1:g.9379A>C, NM_000939.3:c.132+329A>C, NM_001035256.2:c.132+329A>C, NM_001319204.1:c.132+329A>C, NM_001319205.1:c.132+329A>C, XM_005264371.1:c.132+329A>C
      11.

      rs12470143 [Homo sapiens]
        TGTAAAAGCCTCCTCATTTGACCAC[C/T]ACATTTACTCCACCGCAATCTATTC
        Chromosome:
        2:31538488
        Gene:
        SRD5A2 (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by 1000G,by cluster,by frequency,by hapmap
        Global MAF:
        T=0.3684/1845
        HGVS:
        L03843.1:g.1125-4623G>A, NC_000002.11:g.31763558C>T, NC_000002.12:g.31538488C>T, NG_008365.1:g.47484G>A, NM_000348.3:c.282-4722G>A, XM_011533069.2:c.60-4722G>A, XM_011533072.2:c.27-4722G>A
        12.

        rs12467911 [Homo sapiens]
          TCTGGATATCTGTGACCTAGAAATC[C/T]GGAGTACAGCACCCTGGGGGCTCTT
          Chromosome:
          2:31557721
          Gene:
          SRD5A2 (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
          Global MAF:
          T=0.3301/1653
          HGVS:
          L03843.1:g.1124+22799A>G, NC_000002.11:g.31782791T>C, NC_000002.12:g.31557721T>C, NG_008365.1:g.28251A>G, NM_000348.3:c.281+22899A>G, XM_011533069.2:c.59+732A>G, XM_011533072.2:c.27-23955A>G
          14.

          rs12162237 [Homo sapiens]
            ACCTGGCTGAGGGCTGCCCCTGTCT[A/G]GAGATCTCTGCGTCTCTAACACCTT
            Chromosome:
            19:8142186
            Gene:
            FBN3 (GeneView)
            Functional Consequence:
            intron variant
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
            Global MAF:
            G=0.4071/2039
            HGVS:
            NC_000019.10:g.8142186G>A, NC_000019.9:g.8207070G>A, NM_001321431.1:c.542-49C>T, NM_032447.4:c.542-49C>T, XM_005272504.1:c.542-49C>T, XM_005272505.1:c.542-49C>T, XM_017027372.1:c.542-49C>T, XM_017027373.1:c.542-49C>T, XM_017027374.1:c.446-49C>T, XM_017027375.1:c.542-49C>T, XM_017027376.1:c.542-49C>T, XM_017027379.1:c.542-49C>T
            15.

            rs11889731 [Homo sapiens]
              CTAGGAGGTGGTAGGAATAGGTCAC[G/T]AGCTGTTGCTTCATTCATTTCAGAA
              Chromosome:
              2:31527787
              Gene:
              SRD5A2 (GeneView)
              Functional Consequence:
              intron variant
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
              Global MAF:
              G=0.1556/779
              HGVS:
              L03843.1:g.2139+1421A>C, NC_000002.11:g.31752857T>G, NC_000002.12:g.31527787T>G, NG_008365.1:g.58185A>C, NM_000348.3:c.698+1520A>C, XM_011533069.2:c.476+1520A>C, XM_011533072.2:c.443+1520A>C
              16.

              rs11675297 [Homo sapiens]
                ggtcctgatttcttgtcccgtgtcc[A/G]ggaacaatgaggtacgcaaacaact
                Chromosome:
                2:31568349
                Gene:
                SRD5A2 (GeneView)
                Functional Consequence:
                intron variant
                Validated:
                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                Global MAF:
                A=0.1256/629
                HGVS:
                L03843.1:g.1124+12171C>T, NC_000002.11:g.31793419G>A, NC_000002.12:g.31568349G>A, NG_008365.1:g.17623C>T, NM_000348.3:c.281+12271C>T, XM_011533072.2:c.27-34583C>T
                17.

                rs10152450 [Homo sapiens]
                  TAAAACCTTCAGTGGGCTGCTGGGC[G/T]TTAATGTCAAAATAAGCACCTAGAA
                  Chromosome:
                  15:68279141
                  Gene:
                  FEM1B (GeneView)
                  Functional Consequence:
                  intron variant
                  Validated:
                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                  Global MAF:
                  G=0.2436/1220
                  HGVS:
                  NC_000015.10:g.68279141T>G, NC_000015.9:g.68571479T>G, NM_015322.4:c.248+476T>G, XM_017021859.1:c.-227+39T>G
                  18.

                  rs8111933 [Homo sapiens]
                    GGGTGAGTCAGTCCATGGCATTGGT[C/G]TGAGTGAACAGAGAGCCCTAGGGCC
                    Chromosome:
                    19:4795635
                    Gene:
                    FEM1A (GeneView)
                    Functional Consequence:
                    downstream variant 500B
                    Validated:
                    by 1000G,by cluster,by frequency,by hapmap
                    Global MAF:
                    G=0.3556/1781
                    HGVS:
                    NC_000019.10:g.4795635G>C, NC_000019.9:g.4795647G>C, NM_018708.2:c.*1771G>C
                    20.

                    rs7571644 [Homo sapiens]
                      ccacatatcctggaggtgtctccac[A/G]tGCACTATCCACTGGTACAGAAAGG
                      Chromosome:
                      2:31532485
                      Gene:
                      SRD5A2 (GeneView)
                      Functional Consequence:
                      intron variant
                      Validated:
                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                      Global MAF:
                      G=0.1498/750
                      HGVS:
                      L03843.1:g.1487-912T>C, NC_000002.11:g.31757555A>G, NC_000002.12:g.31532485A>G, NG_008365.1:g.53487T>C, NM_000348.3:c.446-1013T>C, XM_011533069.2:c.224-1013T>C, XM_011533072.2:c.191-1013T>C

                      Display Settings:

                      Format
                      Items per page
                      Sort by

                      Send to:

                      Choose Destination

                      Supplemental Content

                      Find related data

                      Recent activity

                      Your browsing activity is empty.

                      Activity recording is turned off.

                      Turn recording back on

                      See more...
                      Support Center