Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 14

1.

rs9479510 [Homo sapiens]
    GCATTTCAGGCTGAAAACAGCTGAG[C/G]AAAGGCACACAGAAGTGGCAAAAGA
    Chromosome:
    6:153106382
    Gene:
    RGS17 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    G=0.4369/2188
    HGVS:
    NC_000006.11:g.153427517G>C, NC_000006.12:g.153106382G>C, NM_012419.4:c.-26+24742C>G, XM_017010733.1:c.-26+24742C>G
    2.

    rs9295740 [Homo sapiens]
      AGGCAGTTCAAATTCTTTGATTTTA[A/G]TGACAAAATGCTTTAAACTGACAAT
      Chromosome:
      6:27721723
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      A=0.2851/1428
      HGVS:
      NC_000006.11:g.27689502G>A, NC_000006.12:g.27721723G>A
      3.

      rs8034191 [Homo sapiens]
        CCCAATGTGGTATAAGTTTTCTGTT[C/T]AGAAAGGCCCTGACAGATAGTAACT
        Chromosome:
        15:78513681
        Gene:
        HYKK (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        C=0.1889/946
        HGVS:
        NC_000015.10:g.78513681T>C, NC_000015.9:g.78806023T>C, NM_001013619.3:c.337+256T>C, NM_001083612.1:c.337+256T>C, XM_011521231.2:c.337+256T>C, XM_017021922.1:c.337+256T>C, XR_243078.1:n.432+256T>C, XR_243078.4:n.432+256T>C
        4.

        rs4083914 [Homo sapiens]
          AGTTCACTGTTTTGTAAGGCAACTG[C/G]TTTCACTGTTGATCAACAATCCTGG
          Chromosome:
          6:153106571
          Gene:
          RGS17 (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 1000G,by cluster,by frequency,by hapmap
          Global MAF:
          C=0.4341/2174
          HGVS:
          NC_000006.11:g.153427706C>G, NC_000006.12:g.153106571C>G, NM_012419.4:c.-26+24553G>C, XM_017010733.1:c.-26+24553G>C
          6.

          rs3117582 [Homo sapiens]
            TAGCCACCTCAATCTTCTAGCGCTC[A/C]AGCGCGCGCACAGACGTGAACGCCG
            Chromosome:
            6:31652743
            Gene:
            APOM (GeneView) BAG6 (GeneView)
            Functional Consequence:
            intron variant,upstream variant 2KB,utr variant 5 prime
            Validated:
            by 1000G,by cluster,by frequency,by hapmap
            Global MAF:
            G=0.0260/130
            HGVS:
            NC_000006.11:g.31620520T>G, NC_000006.12:g.31652743T>G, NM_001098534.1:c.-510A>C, NM_001199697.1:c.-333A>C, NM_001199698.1:c.-333A>C, NM_001256169.1:c.-103+192T>G, NM_004639.3:c.-357A>C, NM_080702.2:c.-333A>C, NM_080703.2:c.-357A>C, NR_045828.1:n.142+192T>G, NT_113891.3:g.3130032G, NT_113891.3:g.3130032G>T, NT_167245.2:g.2900514T>G, NT_167246.2:g.2957789T>G, NT_167247.2:g.2994615T>G, NT_167248.2:g.2908561T>G, NT_167249.2:g.2952020T>G, XM_005249393.1:c.-244A>C, XM_005249394.1:c.-677A>C, XM_005249395.1:c.-333A>C, XM_005249396.1:c.-333A>C, XM_005249397.1:c.-333A>C, XM_005249398.1:c.-333A>C, XM_005249399.1:c.-333A>C, XM_005249400.1:c.-333A>C, XM_005249401.1:c.-333A>C, XM_005272880.1:c.-243A>C, XM_005272881.1:c.-676A>C, XM_005272882.1:c.-332A>C, XM_005272883.1:c.-332A>C, XM_005272884.1:c.-332A>C, XM_005272885.1:c.-332A>C, XM_005272886.1:c.-332A>C, XM_005272887.1:c.-332A>C, XM_005272888.1:c.-332A>C, XM_005275034.1:c.-244A>C, XM_005275035.1:c.-681A>C, XM_005275036.1:c.-333A>C, XM_005275037.1:c.-333A>C, XM_005275038.1:c.-333A>C, XM_005275039.1:c.-333A>C, XM_005275040.1:c.-333A>C, XM_005275041.1:c.-333A>C, XM_005275042.1:c.-333A>C, XM_005275169.1:c.-244A>C, XM_005275170.1:c.-677A>C, XM_005275171.1:c.-333A>C, XM_005275172.1:c.-333A>C, XM_005275173.1:c.-333A>C, XM_005275174.1:c.-333A>C, XM_005275175.1:c.-333A>C, XM_005275176.1:c.-333A>C, XM_005275177.1:c.-333A>C, XM_005275292.1:c.-244A>C, XM_005275293.1:c.-683A>C, XM_005275294.1:c.-333A>C, XM_005275295.1:c.-333A>C, XM_005275296.1:c.-333A>C, XM_005275297.1:c.-333A>C, XM_005275298.1:c.-333A>C, XM_005275299.1:c.-333A>C, XM_005275300.1:c.-333A>C, XM_005275464.1:c.-243A>C, XM_005275465.1:c.-529A>C, XM_005275466.1:c.-684A>C, XM_005275467.1:c.-332A>C, XM_005275468.1:c.-332A>C, XM_005275469.1:c.-332A>C, XM_005275470.1:c.-332A>C, XM_005275471.1:c.-332A>C, XM_005275472.1:c.-332A>C, XM_005275473.1:c.-332A>C, XM_005275597.1:c.-243A>C, XM_005275598.1:c.-680A>C, XM_005275599.1:c.-525A>C, XM_005275600.1:c.-332A>C, XM_005275601.1:c.-332A>C, XM_005275602.1:c.-332A>C, XM_005275603.1:c.-332A>C, XM_005275604.1:c.-332A>C, XM_005275605.1:c.-332A>C, XM_005275606.1:c.-332A>C, XM_011514892.2:c.-333A>C, XM_017011275.1:c.-333A>C, XM_017011276.1:c.-357A>C, XM_017011277.1:c.-510A>C, XM_017011278.1:c.-244A>C, XM_017011279.1:c.-13-967A>C, XM_017011280.1:c.-855A>C, XM_017011281.1:c.-891A>C, XM_017011282.1:c.-677A>C, XM_017011283.1:c.-333A>C, XM_017011284.1:c.-333A>C, XM_017011285.1:c.-333A>C, XM_017011286.1:c.-510A>C, XM_017011287.1:c.-333A>C, XM_017011288.1:c.-333A>C, XM_017011289.1:c.-333A>C, XM_017011290.1:c.-333A>C, XM_017011291.1:c.-333A>C, XM_017011292.1:c.-333A>C, XM_017011293.1:c.-333A>C, XM_017011294.1:c.-333A>C, XM_017011295.1:c.-333A>C, XM_017011296.1:c.-333A>C, XM_017011297.1:c.-333A>C, XM_017011298.1:c.-333A>C
            7.

            rs2736100 [Homo sapiens]
              ATTGTTTTCCGTGTTGAGTGTTTCT[G/T]TAGCTTTGCCCCCGCCCTGCTTTTC
              Chromosome:
              5:1286401
              Gene:
              TERT (GeneView)
              Functional Consequence:
              intron variant
              Clinical significance:
              other
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
              Global MAF:
              C=0.4846/2427
              HGVS:
              NC_000005.10:g.1286401C>A, NC_000005.9:g.1286516C>A, NG_009265.1:g.13647G>T, NM_001193376.1:c.1574-3777G>T, NM_198253.2:c.1574-3777G>T, XM_017009796.1:c.2204-3777G>T, XR_241712.1:n.1648-3777G>T, XR_241713.1:n.1648-3777G>T
              8.

              rs2736098 [Homo sapiens]
                CATCCGTGGGCCGCCAGCACCACGC[A/G]GGCCCCCCATCCACATCGCGGCCAC
                Chromosome:
                5:1293971
                Gene:
                TERT (GeneView)
                Functional Consequence:
                synonymous codon
                Allele Origin:
                G(germline)/A(germline,somatic)
                Clinical significance:
                Benign
                Validated:
                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                Global MAF:
                T=0.2656/1330
                HGVS:
                NC_000005.10:g.1293971C>T, NC_000005.9:g.1294086C>T, NG_009265.1:g.6077G>A, NM_001193376.1:c.915G>A, NM_198253.2:c.915G>A, NP_001180305.1:p.Ala305, NP_937983.2:p.Ala305, XM_017009796.1:c.1545G>A, XP_016865285.1:p.Ala515, XR_241712.1:n.989G>A, XR_241713.1:n.989G>A
                10.

                rs1051730 [Homo sapiens]
                  GGGCCATCATCAAAGCCCCAGGCTA[C/T]AAACACGACATCAAGTACAACTGCT
                  Chromosome:
                  15:78601997
                  Gene:
                  CHRNA3 (GeneView)
                  Functional Consequence:
                  nc transcript variant,synonymous codon
                  Allele Origin:
                  T(germline)/C(germline)
                  Clinical significance:
                  drug-response
                  Validated:
                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                  Global MAF:
                  A=0.1681/842
                  HGVS:
                  NC_000015.10:g.78601997G>A, NC_000015.9:g.78894339G>A, NG_016143.1:g.24299C>T, NM_000743.4:c.645C>T, NM_001166694.1:c.645C>T, NP_000734.2:p.Tyr215, NP_001160166.1:p.Tyr215, NR_046313.1:n.1146C>T, XM_006720382.2:c.444C>T, XP_006720445.1:p.Tyr148
                  11.

                  rs466630 [Homo sapiens]
                    CCCAGGACCCTCCCTCTTCGTCCTC[C/G/T]GCTTGCCTCCAGCTCTCTGGTTTCT
                    Chromosome:
                    5:1415289
                    Gene:
                    SLC6A3 (GeneView)
                    Functional Consequence:
                    intron variant
                    Validated:
                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                    Global MAF:
                    C=0.3303/1654
                    HGVS:
                    NC_000005.10:g.1415289C>A, NC_000005.10:g.1415289C>G, NC_000005.9:g.1415404C>G, NG_015885.1:g.35140G>C, NG_015885.1:g.35140G>T, NM_001044.4:c.1032-474G>C, NM_001044.4:c.1032-474G>T, NT_187547.1:g.95585C, NT_187547.1:g.95585C>G, NT_187547.1:g.95585C>T
                    12.

                    rs402710 [Homo sapiens]
                      GGAGCAACGGCCGAGCATACGCAGC[C/T]GCACTCACCACCGCTGGTACAGGTA
                      Chromosome:
                      5:1320607
                      Gene:
                      CLPTM1L (GeneView)
                      Functional Consequence:
                      intron variant
                      Validated:
                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                      Global MAF:
                      T=0.3359/1682
                      HGVS:
                      NC_000005.10:g.1320607C>T, NC_000005.9:g.1320722C>T, NG_046903.1:g.29459G>A, NM_030782.4:c.1532+9G>A, NT_187547.1:g.193402G>A, XM_005248379.1:c.1529+9G>A, XM_005248380.1:c.1424+9G>A, XM_011514144.2:c.1529+9G>A
                      13.

                      rs401681 [Homo sapiens]
                        CTGCTATCCAGACAACTTCAGAGTC[C/T]ATCATGGTGTGAAGCAGCTTTCTGG
                        Chromosome:
                        5:1321972
                        Gene:
                        CLPTM1L (GeneView)
                        Functional Consequence:
                        intron variant
                        Validated:
                        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                        Global MAF:
                        T=0.4107/2057
                        HGVS:
                        NC_000005.10:g.1321972C>T, NC_000005.9:g.1322087C>T, NG_046903.1:g.28094G>A, NM_030782.4:c.1316-153G>A, NT_187547.1:g.192037G>A, XM_005248379.1:c.1313-153G>A, XM_005248380.1:c.1208-153G>A, XM_011514144.2:c.1313-153G>A
                        14.

                        rs31489 [Homo sapiens]
                          TGAGTTCTTCTTCCTCTTTAAAAGT[A/C]TCTTTTTTGAGACAAGGTCTCGCTG
                          Chromosome:
                          5:1342599
                          Gene:
                          CLPTM1L (GeneView)
                          Functional Consequence:
                          intron variant
                          Validated:
                          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                          Global MAF:
                          A=0.3199/1602
                          HGVS:
                          NC_000005.10:g.1342599C>A, NC_000005.9:g.1342714C>A, NG_046903.1:g.7467G>T, NM_030782.4:c.264-739G>T, NT_187547.1:g.171410G>T, XM_005248379.1:c.264-739G>T, XM_005248380.1:c.264-739G>T, XM_011514144.2:c.264-739G>T

                          Display Settings:

                          Format
                          Items per page
                          Sort by

                          Send to:

                          Choose Destination

                          Supplemental Content

                          Find related data

                          Recent activity

                          Your browsing activity is empty.

                          Activity recording is turned off.

                          Turn recording back on

                          See more...
                          Support Center