Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 7

2.

rs121912584 [Homo sapiens]
    CCTCAGCACCCTGGCCCTCCTCTAC[A/G]GGCCTAAGATTGTGCCCAGGGAGCT
    Chromosome:
    10:71362489
    Gene:
    SLC29A3 (GeneView)
    Functional Consequence:
    missense,nc transcript variant,utr variant 3 prime
    Allele Origin:
    G(germline)/A(germline)
    Clinical significance:
    Pathogenic
    Validated:
    by cluster,by frequency
    HGVS:
    NC_000010.10:g.73122246G>A, NC_000010.11:g.71362489G>A, NG_017066.1:g.48237G>A, NM_001174098.1:c.*538G>A, NM_018344.5:c.1309G>A, NP_060814.4:p.Gly437Arg, NR_033413.1:n.1283G>A, NR_033414.1:n.1056G>A, XM_006717910.3:c.1075G>A, XM_017016377.1:c.871G>A, XM_017016378.1:c.691G>A, XP_006717973.1:p.Gly359Arg, XP_016871866.1:p.Gly291Arg, XP_016871867.1:p.Gly231Arg
    3.

    rs16931177 [Homo sapiens]
      TGGATGCAAAAAGAGATGGTAGAAG[C/G]TTTGCCTCAGAAGACCTTGAGGGGA
      Chromosome:
      10:74111132
      Gene:
      VCL (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by cluster,by frequency,by hapmap
      Global MAF:
      G=0.4189/2098
      HGVS:
      NC_000010.10:g.75870890C>G, NC_000010.11:g.74111132C>G, NG_008868.1:g.118019C>G, NM_003373.3:c.2745+1976C>G, NM_014000.2:c.2746-777C>G, XM_005270142.1:c.2749-777C>G, XM_005270143.1:c.2748+1976C>G
      4.

      rs12411657 [Homo sapiens]
        TAGGGGCTACTCTTCTACGCTCCCA[C/T]TATTTCCTGCATGGTAGTGCTTCTC
        Chromosome:
        10:69796554
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        T=0.2580/1292
        HGVS:
        NC_000010.10:g.71556310C>T, NC_000010.11:g.69796554C>T
        6.

        rs10509322 [Homo sapiens]
          AAATGTTGCCCTTTGCCACATTACA[C/T]TGAACACTGGATGCATGTGGAAAGA
          Chromosome:
          10:70352092
          Gene:
          LRRC20 (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
          Global MAF:
          C=0.3277/1641
          HGVS:
          NC_000010.10:g.72111848C>T, NC_000010.11:g.70352092C>T, NM_001278211.1:c.83-11390G>A, NM_001278212.1:c.83-11390G>A, NM_001278213.1:c.82+24360G>A, NM_001278214.1:c.-125-11390G>A, NM_018205.3:c.83-11390G>A, NM_018239.3:c.82+24360G>A, NM_207119.2:c.83-11390G>A, NR_103467.1:n.103-28062G>A, NR_103468.1:n.103-11390G>A, XM_017016374.1:c.83-11390G>A, XM_017016375.1:c.83-11390G>A
          7.

          rs2277257 [Homo sapiens]
            TCAGCACAGTTCAAACTCCACCTAC[A/G]GAACCACAAGCAGCAGTCTCCGAGC
            Chromosome:
            10:71322806
            Gene:
            SLC29A3 (GeneView)
            Functional Consequence:
            missense,nc transcript variant,utr variant 5 prime
            Allele Origin:
            G(germline)/A(germline)
            Clinical significance:
            Likely benign
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
            Global MAF:
            G=0.4692/2350
            HGVS:
            NC_000010.10:g.73082563A>G, NC_000010.11:g.71322806A>G, NG_017066.1:g.8554A>G, NM_001174098.1:c.52A>G, NM_018344.5:c.52A>G, NP_001167569.1:p.Arg18Gly, NP_060814.4:p.Arg18Gly, NR_033413.1:n.109A>G, NR_033414.1:n.109A>G, XM_006717910.3:c.-183A>G, XM_017016377.1:c.-304A>G, XM_017016378.1:c.-257A>G

            Display Settings:

            Format
            Items per page
            Sort by

            Send to:

            Choose Destination

            Supplemental Content

            Find related data

            Recent activity

            Your browsing activity is empty.

            Activity recording is turned off.

            Turn recording back on

            See more...
            Support Center