Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 9

2.

rs17077540 [Homo sapiens]
    AAGACAAGTGTTTCTTCCAGTAAAC[A/G]CATACTCATCTGAAACATTGATATG
    Chromosome:
    18:67618042
    Gene:
    LOC105372174 (GeneView) LOC643542 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    G=0.0821/411
    HGVS:
    NC_000018.10:g.67618042A>G, NC_000018.9:g.65285279A>G, NR_033921.1:n.204+101293A>G, XR_935590.2:n.2632+5746T>C
    4.

    rs10514718 [Homo sapiens]
      TGCCCAAAGATTGTAATTCCATTCA[C/G]TGGTGGTTATTTGAGTAACATACCA
      Chromosome:
      3:61428140
      Gene:
      LOC105377114 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by cluster,by frequency,by hapmap
      Global MAF:
      G=0.0889/445
      HGVS:
      NC_000003.11:g.61413814C>G, NC_000003.12:g.61428140C>G, XR_001740725.1:n.202+374G>C, XR_940892.2:n.202+374G>C
      5.

      rs9572423 [Homo sapiens]
        TGCACAATCGGAAACTGGTGTAAAT[A/G]TGTTTTAGTACTGACAGACATCATT
        Chromosome:
        13:70272071
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        A=0.2282/1143
        HGVS:
        NC_000013.10:g.70846203G>A, NC_000013.11:g.70272071G>A
        6.

        rs6537837 [Homo sapiens]
          CAGAACCAGGGGATTATGAAGACTT[C/T]ACATGTTAGATAAAGCACCATACCT
          Chromosome:
          1:109577110
          Gene:
          GNAI3 (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
          Global MAF:
          T=0.2316/1160
          HGVS:
          NC_000001.10:g.110119732C>T, NC_000001.11:g.109577110C>T, NG_032795.1:g.33547C>T, NM_006496.3:c.304-2094C>T
          7.

          rs2828520 [Homo sapiens]
            CATGAACAGGCAGACTCGCCCTTCT[A/G]CAAATAGTGACTCAAGGTCACCTGT
            Chromosome:
            21:23770802
            Validated:
            by 1000G,by cluster,by frequency,by hapmap,by submitter
            Global MAF:
            G=0.2999/1502
            HGVS:
            NC_000021.8:g.25143119G>A, NC_000021.9:g.23770802G>A
            8.

            rs882632 [Homo sapiens]
              ggtctgcagtacaacccagggatct[A/G]tactttaacaagcactgtgggtgat
              Chromosome:
              2:29057895
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
              Global MAF:
              T=0.1048/525
              HGVS:
              NC_000002.11:g.29280761C>T, NC_000002.12:g.29057895C>T
              9.

              rs270545 [Homo sapiens]
                CCCTATGTAAAAATGTGGATAATGT[A/G]CTGTGTCGTAAGTTCCAGTGCTTCA
                Chromosome:
                5:38051491
                Gene:
                LOC105374731 (GeneView)
                Functional Consequence:
                intron variant
                Validated:
                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                Global MAF:
                A=0.2578/1291
                HGVS:
                NC_000005.10:g.38051491G>A, NC_000005.9:g.38051593G>A, XR_001742641.1:n.415+10200G>A, XR_001742642.1:n.313+22435G>A, XR_001742643.1:n.457+10200G>A, XR_925930.2:n.313+22435G>A

                Display Settings:

                Format
                Items per page
                Sort by

                Send to:

                Choose Destination

                Supplemental Content

                Find related data

                Recent activity

                Your browsing activity is empty.

                Activity recording is turned off.

                Turn recording back on

                See more...
                Support Center