Display Settings:

Format

Send to:

Choose Destination

Links from PubMed

1.

rs5882 [Homo sapiens]
    TGATTGGCAGAGCAGCTCCGAGTCC[A/G]TCCAGAGCTTCCTGCAGTCAATGAT
    Chromosome:
    16:56982180
    Gene:
    CETP (GeneView)
    Functional Consequence:
    missense
    Allele Origin:
    G(germline)/A(germline)
    Clinical significance:
    other
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
    Global MAF:
    G=0.4661/2334
    HGVS:
    NC_000016.10:g.56982180G>A, NC_000016.9:g.57016092G>A, NG_008952.1:g.25258G>A, NM_000078.2:c.1264G>A, NM_001286085.1:c.1084G>A, NP_000069.2:p.Val422Ile, NP_001273014.1:p.Val362Ile, XM_005255776.1:c.1084G>A, XP_005255833.1:p.Val362Ile

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center