Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 3

1.

rs12477914 [Homo sapiens]
    TATTATATATCATCAAGATTGCTTA[G/T]TAGAAGCAGGGACATGGGCAAGAGG
    Chromosome:
    2:185001013
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
    Global MAF:
    G=0.1629/816
    HGVS:
    NC_000002.11:g.185865740T>G, NC_000002.12:g.185001013T>G
    2.

    rs1366840 [Homo sapiens]
      ATAGAAAGTACTGATAAAACTAGAA[A/G]AGTATAGATCTGTATTACAGAGAAA
      Chromosome:
      2:184903127
      Gene:
      ZNF804A (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
      Global MAF:
      T=0.4722/2365
      HGVS:
      NC_000002.11:g.185767854C>T, NC_000002.12:g.184903127C>T, NG_046950.1:g.309762C>T, NM_194250.1:c.256-30476C>T
      3.

      rs1344706 [Homo sapiens]
        aacactgaaacaaagaatcaaaaac[A/G/T]atcagaatcaacttcttggatatct
        Chromosome:
        2:184913701
        Gene:
        ZNF804A (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        C=0.3045/1525
        HGVS:
        NC_000002.11:g.185778428A>C, NC_000002.12:g.184913701A>C, NC_000002.12:g.184913701A>T, NG_046950.1:g.320336A>C, NG_046950.1:g.320336A>T, NM_194250.1:c.256-19902A>C, NM_194250.1:c.256-19902A>T

        Display Settings:

        Format
        Sort by

        Send to:

        Choose Destination

        Supplemental Content

        Find related data

        Recent activity

        Your browsing activity is empty.

        Activity recording is turned off.

        Turn recording back on

        See more...
        Support Center