Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 6

1.

rs10492497 [Homo sapiens]
    GTGAAGACTTAACAGATACTGCCAA[C/T]GCATTTAGTAAGAATATTATCTGCT
    Chromosome:
    13:110179519
    Gene:
    COL4A1 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    C=0.0877/439
    HGVS:
    NC_000013.10:g.110831866T>C, NC_000013.11:g.110179519T>C, NG_011544.2:g.132631A>G, NM_001845.5:c.2194-98A>G, XM_011521048.2:c.2002-98A>G
    2.

    rs3742207 [Homo sapiens]
      GAATTAAAGGTGATCAAGGCGATCA[A/C/T]GGCGTCCCGGGAGCTAAAGGTAGGA
      Chromosome:
      13:110166251
      Gene:
      COL4A1 (GeneView)
      Functional Consequence:
      missense
      Clinical significance:
      Benign
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      G=0.2883/1444
      HGVS:
      NC_000013.10:g.110818598T>G, NC_000013.11:g.110166251T>G, NG_011544.2:g.145899A>C, NM_001845.5:c.4002A>C, NP_001836.3:p.Gln1334His, XM_011521048.2:c.3810A>C, XP_011519350.1:p.Gln1270His
      3.

      rs2391823 [Homo sapiens]
        TTCATATATTTCCAATCTGGAGGTG[A/G]TTATTTTtgttagtccattctcaca
        Chromosome:
        13:110292448
        Gene:
        COL4A1 (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        G=0.2396/1200
        HGVS:
        NC_000013.10:g.110944795G>A, NC_000013.11:g.110292448G>A, NG_011544.2:g.19702C>T, NM_001303110.1:c.84+14496C>T, NM_001845.5:c.84+14496C>T, XM_011521048.2:c.-109+6157C>T
        4.

        rs2131939 [Homo sapiens]
          GCAGTATCTGTTAAGTCTTCACTTA[C/T]GCTATTGGTTTGATAAAAATACTGA
          Chromosome:
          13:110179490
          Gene:
          COL4A1 (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
          Global MAF:
          A=0.0745/373
          HGVS:
          NC_000013.10:g.110831837G>A, NC_000013.11:g.110179490G>A, NG_011544.2:g.132660C>T, NM_001845.5:c.2194-69C>T, XM_011521048.2:c.2002-69C>T
          6.

          rs496916 [Homo sapiens]
            ACAGAAGCTCACATCAGTAACCTCA[A/C/G]GGCCACTTAGCAACTACAGCATAAA
            Chromosome:
            13:110198667
            Gene:
            COL4A1 (GeneView)
            Functional Consequence:
            intron variant
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
            Global MAF:
            C=0.3886/1946
            HGVS:
            NC_000013.10:g.110851014G>A, NC_000013.10:g.110851014G>C, NC_000013.11:g.110198667G>A, NC_000013.11:g.110198667G>C, NG_011544.2:g.113483C>G, NG_011544.2:g.113483C>T, NM_001303110.1:c.1121-36C>G, NM_001303110.1:c.1121-36C>T, NM_001845.5:c.1121-36C>G, NM_001845.5:c.1121-36C>T, XM_011521048.2:c.929-36C>G, XM_011521048.2:c.929-36C>T

            Display Settings:

            Format
            Items per page
            Sort by

            Send to:

            Choose Destination

            Supplemental Content

            Find related data

            Recent activity

            Your browsing activity is empty.

            Activity recording is turned off.

            Turn recording back on

            See more...
            Support Center