Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 1 to 20 of 25

1.

rs16981804 [Homo sapiens]
    ACAACAACAACAAAACCCAGGGAAA[C/T]GTACCTTGGTGTGAACAGCACTGAA
    Chromosome:
    X:22161452
    Gene:
    PHEX (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    HGVS:
    NC_000023.10:g.22179569C>T, NC_000023.11:g.22161452C>T, NG_007563.2:g.133649C>T, NM_000444.5:c.1405-6860C>T, NM_001282754.1:c.1405-6860C>T, XM_005274547.1:c.514-6860C>T, XM_011545533.1:c.649-6860C>T, XM_011545536.2:c.298-6860C>T, XM_017029579.1:c.649-6860C>T, XR_001755695.1:n.2245-6860C>T
    2.

    rs10500635 [Homo sapiens]
      CAAGCATACTGTAGAAATCGCTGTG[A/G]AGAGATGCATTTAGATGAAAAGGTA
      Chromosome:
      11:5365438
      Gene:
      OR51B5 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      A=0.2370/1187
      HGVS:
      NC_000011.10:g.5365438G>A, NC_000011.9:g.5386668G>A, NM_001005567.2:c.-359-18528C>T, NR_038321.1:n.85-18528C>T
      3.

      rs9494145 [Homo sapiens]
        ATACTCTAAAAGCCCCTCCATACCA[C/T]CCCTAATACTTTAAAAGCCGCTAGA
        Chromosome:
        6:135111414
        Validated:
        by 1000G,by cluster,by frequency,by hapmap
        Global MAF:
        C=0.1468/735
        HGVS:
        NC_000006.11:g.135432552T>C, NC_000006.12:g.135111414T>C
        4.

        rs9399137 [Homo sapiens]
          GTAATTAACTGAACATATGGTTATT[C/T]ACAGTTTTTTCACAAGCAACCCTGC
          Chromosome:
          6:135097880
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
          Global MAF:
          C=0.1540/771
          HGVS:
          NC_000006.11:g.135419018T>C, NC_000006.12:g.135097880T>C
          5.

          rs7483122 [Homo sapiens]
            GTTCTGTGGTTAGATCACAGGGAGA[C/T]TGGCCATGGAGCCTGCTTCTCTCAG
            Chromosome:
            11:5351776
            Gene:
            OR51B5 (GeneView) OR51B6 (GeneView)
            Functional Consequence:
            intron variant,missense
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
            Global MAF:
            C=0.2340/1172
            HGVS:
            NC_000011.10:g.5351776T>C, NC_000011.9:g.5373006T>C, NM_001004750.1:c.269T>C, NM_001005567.2:c.-359-4866A>G, NP_001004750.1:p.Ile90Thr, NR_038321.1:n.85-4866A>G
            6.

            rs7482144 [Homo sapiens]
              AACCCATGGGTGGAGTTTAGCCAGG[A/G]ACCGTTTCAGACAGATATTTGCATT
              Chromosome:
              11:5250015
              Gene:
              HBG1 (GeneView)
              Functional Consequence:
              upstream variant 2KB
              Allele Origin:
              G(germline)/A(germline)
              Clinical significance:
              Uncertain significance
              Validated:
              by 1000G,by cluster,by frequency
              HGVS:
              NC_000011.10:g.5250015G>A, NC_000011.10:g.5254939G>A, NC_000011.9:g.5271245G>A, NC_000011.9:g.5276169G>A, NG_000007.3:g.42677C>T, NG_000007.3:g.47601C>T, NM_000184.2:c.-211C>T, NM_000559.2:c.-211C>T
              7.
              8.

              rs6530488 [Homo sapiens]
                TTGTTTAATAAGCTCTGCTCAAAAG[C/T]TGACTTTTTTTTCAGATTATGGGTC
                Chromosome:
                X:12182662
                Gene:
                FRMPD4 (GeneView)
                Functional Consequence:
                intron variant
                Validated:
                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                Global MAF:
                C=0.1266/478
                HGVS:
                NC_000023.10:g.12200781C>T, NC_000023.11:g.12182662C>T, NG_016419.1:g.49197C>T, NM_014728.3:c.41+43650C>T, XM_011545613.2:c.41+43650C>T, XM_017029983.1:c.32+44897C>T, XM_017029986.1:c.32+44897C>T
                9.

                rs5024042 [Homo sapiens]
                  CTCATGTCGTTCACATCACAATGAG[A/C]TACATCCACTTCCTTTTCCCACCTT
                  Chromosome:
                  11:5352332
                  Gene:
                  OR51B5 (GeneView) OR51B6 (GeneView)
                  Functional Consequence:
                  intron variant,missense
                  Validated:
                  by 1000G,by cluster,by frequency
                  Global MAF:
                  A=0.2324/1164
                  HGVS:
                  NC_000011.10:g.5352332C>A, NC_000011.9:g.5373562C>A, NM_001004750.1:c.825C>A, NM_001005567.2:c.-359-5422G>T, NP_001004750.1:p.Ser275Arg, NR_038321.1:n.85-5422G>T
                  10.

                  rs5006884 [Homo sapiens]
                    GTTTCCCTACTGTCGATCCCATGTA[C/T]TCTCCCATGCTTTCTGTCTACACCA
                    Chromosome:
                    11:5352021
                    Gene:
                    OR51B5 (GeneView) OR51B6 (GeneView)
                    Functional Consequence:
                    intron variant,missense
                    Validated:
                    by 1000G,by cluster,by frequency
                    Global MAF:
                    T=0.2336/1170
                    HGVS:
                    NC_000011.10:g.5352021C>T, NC_000011.9:g.5373251C>T, NM_001004750.1:c.514C>T, NM_001005567.2:c.-359-5111G>A, NP_001004750.1:p.Leu172Phe, NR_038321.1:n.85-5111G>A
                    11.

                    rs5006883 [Homo sapiens]
                      CAAGCTAGCCTGTGCTGACATCACC[C/T]TCAACCGTCTCTATCCAGTTGTAGT
                      Chromosome:
                      11:5352081
                      Gene:
                      OR51B5 (GeneView) OR51B6 (GeneView)
                      Functional Consequence:
                      intron variant,missense
                      Validated:
                      by 1000G,by cluster,by frequency
                      Global MAF:
                      C=0.2340/1172
                      HGVS:
                      NC_000011.10:g.5352081T>C, NC_000011.9:g.5373311T>C, NM_001004750.1:c.574T>C, NM_001005567.2:c.-359-5171A>G, NP_001004750.1:p.Phe192Leu, NR_038321.1:n.85-5171A>G
                      12.

                      rs4969555 [Homo sapiens]
                        AATTTGATCAACGGAACAAGTTGCA[A/G/T]TTAAACTTAGGTTGTTTCCTTGTTT
                        Chromosome:
                        X:24056464
                        Gene:
                        EIF2S3 (GeneView)
                        Functional Consequence:
                        intron variant
                        Validated:
                        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                        Global MAF:
                        G=0.4244/1602
                        HGVS:
                        NC_000023.10:g.24074581A>G, NC_000023.11:g.24056464A>G, NC_000023.11:g.24056464A>T, NG_016387.1:g.6517A>G, NG_016387.1:g.6517A>T, NM_001415.3:c.133+786A>G, NM_001415.3:c.133+786A>T
                        13.

                        rs4969549 [Homo sapiens]
                          gtgtttttttatttctagaaggtct[A/G]ttttgtttttCCAAGTATTTGGGGT
                          Chromosome:
                          X:24247832
                          Validated:
                          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                          Global MAF:
                          G=0.3611/1363
                          HGVS:
                          NC_000023.10:g.24265949A>G, NC_000023.11:g.24247832A>G
                          14.

                          rs4910756 [Homo sapiens]
                            GCCTACATCTCCATACTTCTTGGCA[A/G]TGGCACTCTTCTCTTTCTCATCAGG
                            Chromosome:
                            11:5351626
                            Gene:
                            OR51B5 (GeneView) OR51B6 (GeneView)
                            Functional Consequence:
                            intron variant,missense
                            Validated:
                            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                            Global MAF:
                            G=0.1508/755
                            HGVS:
                            NC_000011.10:g.5351626A>G, NC_000011.9:g.5372856A>G, NM_001004750.1:c.119A>G, NM_001005567.2:c.-359-4716T>C, NP_001004750.1:p.Asn40Ser, NR_038321.1:n.85-4716T>C
                            15.
                            16.

                            rs4895441 [Homo sapiens]
                              ctggggaaagactctttgtaaagtg[A/G]tacatgagcagagaactgagtaagt
                              Chromosome:
                              6:135105435
                              Gene:
                              LOC105378010 (GeneView)
                              Functional Consequence:
                              upstream variant 2KB
                              Allele Origin:
                              G(inherited)/A(germline,inherited)
                              Clinical significance:
                              Likely pathogenic
                              Validated:
                              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                              Global MAF:
                              G=0.1753/878
                              HGVS:
                              NC_000006.11:g.135426573A>G, NC_000006.12:g.135105435A>G, XR_001743891.1:n.-1946A>G, XR_943010.2:n.-1410A>G
                              17.

                              rs3886223 [Homo sapiens]
                                GCTATATTTTCTATTTTTGAATAGA[G/T]CCTTGACCCTTCCTATTATTAGGCC
                                Chromosome:
                                11:5322517
                                Validated:
                                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                Global MAF:
                                T=0.3053/1529
                                HGVS:
                                NC_000011.10:g.5322517G>T, NC_000011.9:g.5343747G>T
                                18.

                                rs2071348 [Homo sapiens]
                                  AAAATTTGGTAGAGCAAGGACTATG[A/C]ATAATGGAAGGCCACTTACCATTTG
                                  Chromosome:
                                  11:5242916
                                  Gene:
                                  HBBP1 (GeneView)
                                  Functional Consequence:
                                  intron variant
                                  Validated:
                                  by 1000G,by cluster,by frequency,by hapmap,by submitter
                                  Global MAF:
                                  G=0.2063/1033
                                  HGVS:
                                  NC_000011.10:g.5242916T>G, NC_000011.9:g.5264146T>G, NG_000007.3:g.54700A>C, NR_001589.1:n.366+190A>C
                                  19.

                                  rs1391619 [Homo sapiens]
                                    TTTTCCATCCACAGATTGAGTTAAT[C/T]TTTTGAGCTATGGTCTCCTTGACGT
                                    Chromosome:
                                    11:5434699
                                    Gene:
                                    OR51B5 (GeneView)
                                    Functional Consequence:
                                    intron variant
                                    Validated:
                                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                    Global MAF:
                                    G=0.2001/1002
                                    HGVS:
                                    NC_000011.10:g.5434699G>A, NC_000011.9:g.5455929G>A, NM_001005567.2:c.-360+70870C>T, NR_038321.1:n.84+70870C>T
                                    20.

                                    rs968856 [Homo sapiens]
                                      ATTATGAGTATTACACTATCCATAG[A/G]GAAGTTTGTTTGAGACCTAAACTGA
                                      Chromosome:
                                      11:5239346
                                      Validated:
                                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                      Global MAF:
                                      T=0.4744/2376
                                      HGVS:
                                      NC_000011.10:g.5239346T>C, NC_000011.9:g.5260576T>C, NG_000007.3:g.58270A>G

                                      Display Settings:

                                      Format
                                      Items per page
                                      Sort by

                                      Send to:

                                      Choose Destination

                                      Supplemental Content

                                      Find related data

                                      Recent activity

                                      Your browsing activity is empty.

                                      Activity recording is turned off.

                                      Turn recording back on

                                      See more...
                                      Support Center