Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 5

2.

rs2763979 [Homo sapiens]
    ACTGTGAGGTCCTACTTCTACACAC[C/T]GTCCAGGAGTGAACCAGGAATTGAG
    Chromosome:
    6:31826815
    Gene:
    HSPA1B (GeneView)
    Functional Consequence:
    upstream variant 2KB
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
    Global MAF:
    T=0.4483/2245
    HGVS:
    NC_000006.11:g.31794592C>T, NC_000006.12:g.31826815C>T, NM_005346.4:c.-1136C>T, NT_113891.3:g.3304068T, NT_113891.3:g.3304068T>C, NT_167244.2:g.3159440C>T, NT_167245.2:g.3074594C>T, NT_167248.2:g.3082647T, NT_167248.2:g.3082647T>C, XM_005249069.1:c.-748-388C>T, XM_005272812.1:c.-748-388C>T, XM_005274857.1:c.-748-388C>T, XM_005274969.1:c.-748-388C>T, XM_005275397.1:c.-748-388C>T
    3.

    rs2227956 [Homo sapiens]
      AATGGTATTCTCAATGTCACAGCCA[C/T]GGACAAGAGCACCGGCAAGGTGAAC
      Chromosome:
      6:31810495
      Gene:
      HSPA1L (GeneView)
      Functional Consequence:
      missense
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      G=0.1228/615
      HGVS:
      NC_000006.11:g.31778272G>A, NC_000006.12:g.31810495G>A, NG_011855.1:g.9564C>T, NM_005527.3:c.1478C>T, NP_005518.3:p.Thr493Met, NT_113891.2:g.3287853A, NT_113891.2:g.3287853A>G, NT_113891.3:g.3287747A, NT_113891.3:g.3287747A>G, NT_167244.1:g.3093033A, NT_167244.1:g.3093033A>G, NT_167244.2:g.3143117A, NT_167244.2:g.3143117A>G, NT_167245.1:g.3063859G>A, NT_167245.2:g.3058274G>A, NT_167248.1:g.3071920A, NT_167248.1:g.3071920A>G, NT_167248.2:g.3066324A, NT_167248.2:g.3066324A>G, XM_005249070.1:c.1670C>T, XM_005249071.1:c.1478C>T, XM_005249072.1:c.1478C>T, XM_005249073.1:c.1478C>T, XM_005249074.1:c.1478C>T, XM_005272813.1:c.1670T, XM_005272813.1:c.1670T>C, XM_005272814.1:c.1478T, XM_005272814.1:c.1478T>C, XM_005272815.1:c.1478T, XM_005272815.1:c.1478T>C, XM_005272816.1:c.1478T, XM_005272816.1:c.1478T>C, XM_005272817.1:c.1478T, XM_005272817.1:c.1478T>C, XM_005274858.1:c.1478T, XM_005274858.1:c.1478T>C, XM_005274859.1:c.1670T, XM_005274859.1:c.1670T>C, XM_005274860.1:c.1478T, XM_005274860.1:c.1478T>C, XM_005274861.1:c.1478T, XM_005274861.1:c.1478T>C, XM_005274862.1:c.1478T, XM_005274862.1:c.1478T>C, XM_005274970.1:c.1670C>T, XM_005274971.1:c.1478C>T, XM_005274972.1:c.1478C>T, XM_005274973.1:c.1478C>T, XM_005274974.1:c.1478C>T, XM_005275398.1:c.1478T, XM_005275398.1:c.1478T>C, XM_005275399.1:c.1670T, XM_005275399.1:c.1670T>C, XM_005275400.1:c.1478T, XM_005275400.1:c.1478T>C, XM_005275401.1:c.1478T, XM_005275401.1:c.1478T>C, XM_005275402.1:c.1478T, XM_005275402.1:c.1478T>C, XP_005249127.1:p.Thr557Met, XP_005249128.1:p.Thr493Met, XP_005249129.1:p.Thr493Met, XP_005249130.1:p.Thr493Met, XP_005249131.1:p.Thr493Met, XP_005272870.1:p.Met557, XP_005272870.1:p.Met557Thr, XP_005272871.1:p.Met493, XP_005272871.1:p.Met493Thr, XP_005272872.1:p.Met493, XP_005272872.1:p.Met493Thr, XP_005272873.1:p.Met493, XP_005272873.1:p.Met493Thr, XP_005272874.1:p.Met493, XP_005272874.1:p.Met493Thr, XP_005274915.1:p.Met493, XP_005274915.1:p.Met493Thr, XP_005274916.1:p.Met557, XP_005274916.1:p.Met557Thr, XP_005274917.1:p.Met493, XP_005274917.1:p.Met493Thr, XP_005274918.1:p.Met493, XP_005274918.1:p.Met493Thr, XP_005274919.1:p.Met493, XP_005274919.1:p.Met493Thr, XP_005275027.1:p.Thr557Met, XP_005275028.1:p.Thr493Met, XP_005275029.1:p.Thr493Met, XP_005275030.1:p.Thr493Met, XP_005275031.1:p.Thr493Met, XP_005275455.1:p.Met493, XP_005275455.1:p.Met493Thr, XP_005275456.1:p.Met557, XP_005275456.1:p.Met557Thr, XP_005275457.1:p.Met493, XP_005275457.1:p.Met493Thr, XP_005275458.1:p.Met493, XP_005275458.1:p.Met493Thr, XP_005275459.1:p.Met493, XP_005275459.1:p.Met493Thr
      4.

      rs1061581 [Homo sapiens]
      • Suspected
      TCCCCAAGGTGCAGAAGCTGCTGCA[A/G]GACTTCTTCAACGGGCGCGACCTGA
      Chromosome:
      6:31816809
      Gene:
      HSPA1A (GeneView) HSPA1L (GeneView)
      Functional Consequence:
      synonymous codon,upstream variant 2KB
      Validated:
      by cluster,by frequency
      HGVS:
      NC_000006.11:g.31784586G>A, NC_000006.12:g.31816809G>A, NG_011855.1:g.3250C>T, NM_005345.5:c.1053G>A, NM_005527.3:c.-1934C>T, NP_005336.3:p.Gln351, NT_113891.2:g.3294166G>A, NT_113891.3:g.3294060G>A, NT_167244.1:g.3099347G>A, NT_167244.2:g.3149431G>A, NT_167245.1:g.3070173G>A, NT_167245.2:g.3064588G>A, NT_167248.1:g.3078233G>A, NT_167248.2:g.3072637G>A, XM_005249067.1:c.558G>A, XM_005249068.1:c.342G>A, XM_005249070.1:c.-1742C>T, XM_005249071.1:c.-1373C>T, XM_005249072.1:c.-13-4824C>T, XM_005249073.1:c.-14+4204C>T, XM_005249074.1:c.-1242C>T, XM_005272811.1:c.342G>A, XM_005272813.1:c.-1742C>T, XM_005272814.1:c.-1242C>T, XM_005272815.1:c.-13-4823C>T, XM_005272816.1:c.-14+4206C>T, XM_005272817.1:c.-1373C>T, XM_005274856.1:c.342G>A, XM_005274858.1:c.-1242C>T, XM_005274859.1:c.-1742C>T, XM_005274860.1:c.-13-4824C>T, XM_005274861.1:c.-14+4207C>T, XM_005274862.1:c.-1373C>T, XM_005274968.1:c.342G>A, XM_005274970.1:c.-1742C>T, XM_005274971.1:c.-1242C>T, XM_005274972.1:c.-13-4824C>T, XM_005274973.1:c.-14+4204C>T, XM_005274974.1:c.-1373C>T, XM_005275395.1:c.558G>A, XM_005275396.1:c.342G>A, XM_005275398.1:c.-1242C>T, XM_005275399.1:c.-1742C>T, XM_005275400.1:c.-13-4823C>T, XM_005275401.1:c.-14+4206C>T, XM_005275402.1:c.-1373C>T, XP_005249124.1:p.Gln186, XP_005249125.1:p.Gln114, XP_005272868.1:p.Gln114, XP_005274913.1:p.Gln114, XP_005275025.1:p.Gln114, XP_005275452.1:p.Gln186, XP_005275453.1:p.Gln114
      5.

      rs1043618 [Homo sapiens]
        CGTTTCCAGCCCCCAATCTCAGAGC[C/G/T]GAGCCGACAGAGAGCAGGGAACCGG
        Chromosome:
        6:31815730
        Gene:
        HSPA1A (GeneView) HSPA1L (GeneView)
        Functional Consequence:
        upstream variant 2KB,utr variant 5 prime
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
        Global MAF:
        C=0.4812/2410
        HGVS:
        NC_000006.11:g.31783507G>C, NC_000006.11:g.31783507G>T, NC_000006.12:g.31815730G>C, NC_000006.12:g.31815730G>T, NG_011855.1:g.4329C>A, NG_011855.1:g.4329C>G, NM_005345.5:c.-27G>C, NM_005345.5:c.-27G>T, NM_005527.3:c.-855C>A, NM_005527.3:c.-855C>G, NT_113891.2:g.3293087C, NT_113891.2:g.3293087C>G, NT_113891.2:g.3293087C>T, NT_113891.3:g.3292981C, NT_113891.3:g.3292981C>G, NT_113891.3:g.3292981C>T, NT_167244.1:g.3098268G>C, NT_167244.1:g.3098268G>T, NT_167244.2:g.3148352G>C, NT_167244.2:g.3148352G>T, NT_167245.1:g.3069094G>C, NT_167245.1:g.3069094G>T, NT_167245.2:g.3063509G>C, NT_167245.2:g.3063509G>T, NT_167248.1:g.3077154C, NT_167248.1:g.3077154C>G, NT_167248.1:g.3077154C>T, NT_167248.2:g.3071558C, NT_167248.2:g.3071558C>G, NT_167248.2:g.3071558C>T, XM_005249067.1:c.-27G>C, XM_005249067.1:c.-27G>T, XM_005249068.1:c.-27G>C, XM_005249068.1:c.-27G>T, XM_005249070.1:c.-663C>A, XM_005249070.1:c.-663C>G, XM_005249071.1:c.-294C>A, XM_005249071.1:c.-294C>G, XM_005249072.1:c.-13-3745C>A, XM_005249072.1:c.-13-3745C>G, XM_005249073.1:c.-13-3745C>A, XM_005249073.1:c.-13-3745C>G, XM_005249074.1:c.-163C>A, XM_005249074.1:c.-163C>G, XM_005272811.1:c.-27C, XM_005272811.1:c.-27C>G, XM_005272811.1:c.-27C>T, XM_005272813.1:c.-663C>A, XM_005272813.1:c.-663C>G, XM_005272814.1:c.-163C>A, XM_005272814.1:c.-163C>G, XM_005272815.1:c.-13-3744C>A, XM_005272815.1:c.-13-3744C>G, XM_005272816.1:c.-13-3744C>A, XM_005272816.1:c.-13-3744C>G, XM_005272817.1:c.-294C>A, XM_005272817.1:c.-294C>G, XM_005274856.1:c.-27G>C, XM_005274856.1:c.-27G>T, XM_005274858.1:c.-163C>A, XM_005274858.1:c.-163C>G, XM_005274859.1:c.-663C>A, XM_005274859.1:c.-663C>G, XM_005274860.1:c.-13-3745C>A, XM_005274860.1:c.-13-3745C>G, XM_005274861.1:c.-13-3745C>A, XM_005274861.1:c.-13-3745C>G, XM_005274862.1:c.-294C>A, XM_005274862.1:c.-294C>G, XM_005274968.1:c.-27G>C, XM_005274968.1:c.-27G>T, XM_005274970.1:c.-663C>A, XM_005274970.1:c.-663C>G, XM_005274971.1:c.-163C>A, XM_005274971.1:c.-163C>G, XM_005274972.1:c.-13-3745C>A, XM_005274972.1:c.-13-3745C>G, XM_005274973.1:c.-13-3745C>A, XM_005274973.1:c.-13-3745C>G, XM_005274974.1:c.-294C>A, XM_005274974.1:c.-294C>G, XM_005275395.1:c.-27C, XM_005275395.1:c.-27C>G, XM_005275395.1:c.-27C>T, XM_005275396.1:c.-27C, XM_005275396.1:c.-27C>G, XM_005275396.1:c.-27C>T, XM_005275398.1:c.-163G, XM_005275398.1:c.-163G>A, XM_005275398.1:c.-163G>C, XM_005275399.1:c.-663C>A, XM_005275399.1:c.-663C>G, XM_005275400.1:c.-13-3744C>A, XM_005275400.1:c.-13-3744C>G, XM_005275401.1:c.-13-3744C>A, XM_005275401.1:c.-13-3744C>G, XM_005275402.1:c.-294C>A, XM_005275402.1:c.-294C>G

        Display Settings:

        Format
        Sort by

        Send to:

        Choose Destination

        Supplemental Content

        Find related data

        Recent activity

        Your browsing activity is empty.

        Activity recording is turned off.

        Turn recording back on

        See more...
        Support Center