Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 1 to 20 of 36

1.

rs17331332 [Homo sapiens]
    TGATATAGTACGTTTAACGAGAAAA[A/G]AGAAGACGTAACATTTTCTCAAAGA
    Chromosome:
    4:105886950
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    A=0.0266/133
    HGVS:
    NC_000004.11:g.106808107G>A, NC_000004.12:g.105886950G>A, XR_244687.1:n.345+8829C>T
    2.

    rs17036341 [Homo sapiens]
      TTTACTTTAGCTATGATAATTCAAA[C/G]TGAATGTGAGTTCACTACACAAAGC
      Chromosome:
      4:105875672
      Validated:
      by 1000G,by cluster,by frequency,by hapmap
      Global MAF:
      G=0.0996/499
      HGVS:
      NC_000004.11:g.106796829C>G, NC_000004.12:g.105875672C>G, XR_244687.1:n.345+20107G>C
      3.

      rs17036090 [Homo sapiens]
        TGAATAATGGGGATGAGCTAGTGGA[C/T]ATTCACAACCTGGCAGTACTGATTT
        Chromosome:
        4:105672417
        Gene:
        ARHGEF38 (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by 1000G,by cluster,by frequency,by hapmap
        Global MAF:
        C=0.0300/150
        HGVS:
        NC_000004.11:g.106593574T>C, NC_000004.12:g.105672417T>C, NM_001242729.1:c.2148+4714T>C, XM_006714244.3:c.1494+4714T>C, XM_011532050.2:c.1653+4714T>C, XR_001741247.1:n.2309+4714T>C, XR_427548.3:n.2309+4714T>C, XR_938748.2:n.2309+4714T>C, XR_938749.2:n.2309+4714T>C, XR_938750.2:n.2309+4714T>C
        4.
        6.

        rs16909898 [Homo sapiens]
          TTCTGTTATTTTTTTGAAGACAGGA[A/G]GAGCCTTAAGTTGTGGCAGATTACC
          Chromosome:
          9:95468726
          Gene:
          LOC100507346 (GeneView) PTCH1 (GeneView)
          Functional Consequence:
          intron variant,nc transcript variant
          Clinical significance:
          Benign
          Validated:
          by 1000G,by cluster,by frequency,by hapmap
          Global MAF:
          G=0.0879/440
          HGVS:
          NC_000009.11:g.98231008A>G, NC_000009.12:g.95468726A>G, NG_007664.1:g.53240T>C, NM_000264.3:c.2250+25T>C, NM_001083602.1:c.2052+25T>C, NM_001083603.1:c.2247+25T>C, NM_001083604.1:c.1797+25T>C, NM_001083605.1:c.1797+25T>C, NM_001083606.1:c.1797+25T>C, NM_001083607.1:c.1797+25T>C, NR_038982.1:n.664A>G, XM_005252102.1:c.1797+25T>C, XM_005252103.1:c.1410+25T>C, XR_242599.1:n.2641+25T>C
          7.

          rs11728716 [Homo sapiens]
            CTATCCAGGAGACAGGCAACTAGAA[A/G]TCTATTGGCTTTAGCACTTCTCTCT
            Chromosome:
            4:105834839
            Gene:
            GSTCD (GeneView)
            Functional Consequence:
            downstream variant 500B,intron variant
            Validated:
            by 1000G,by cluster,by frequency,by hapmap
            Global MAF:
            A=0.0254/127
            HGVS:
            NC_000004.11:g.106755996G>A, NC_000004.12:g.105834839G>A, NM_001031720.3:c.1664+245G>A, NM_024751.3:c.1403+245G>A, XM_005263222.1:c.1664+245G>A, XM_005263222.3:c.1664+245G>A, XM_011532248.2:c.1664+245G>A, XM_011532249.2:c.1664+245G>A, XM_011532252.2:c.1664+245G>A, XR_244687.1:n.345+60940C>T, XR_938771.1:n.2276G>A
            8.
            9.

            rs11168048 [Homo sapiens]
              gatattagcaaatcaagtctaacaa[C/T]gtatacacagaattgcccacccaac
              Chromosome:
              5:148462790
              Gene:
              HTR4 (GeneView) LOC107986462 (GeneView)
              Functional Consequence:
              intron variant
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
              Global MAF:
              C=0.4301/2154
              HGVS:
              NC_000005.10:g.148462790T>C, NC_000005.9:g.147842353T>C, NG_029052.1:g.196387A>G, NM_001040169.2:c.1077-11518A>G, NM_199453.3:c.*15+3060A>G, XR_001742935.1:n.679-6130T>C
              11.

              rs11097901 [Homo sapiens]
                aacaatttataacttttaaatagca[C/T]atcattctaagtagcatgatgaaat
                Chromosome:
                4:105808776
                Gene:
                GSTCD (GeneView)
                Functional Consequence:
                intron variant
                Validated:
                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                Global MAF:
                T=0.0361/181
                HGVS:
                NC_000004.11:g.106729933C>T, NC_000004.12:g.105808776C>T, NM_001031720.3:c.1241-14178C>T, NM_024751.3:c.980-14178C>T, XM_005263222.1:c.1241-14178C>T, XM_005263222.3:c.1241-14178C>T, XM_011532248.2:c.1241-14178C>T, XM_011532249.2:c.1241-14178C>T, XM_011532252.2:c.1241-14178C>T, XR_244687.1:n.346-55475G>A, XR_938771.1:n.1501-14178C>T
                13.

                rs10516529 [Homo sapiens]
                  TATAGAGAGTGAGTTGTAAAATTTA[G/T]GAGTCACTTTACATTCGCCCTACTC
                  Chromosome:
                  4:105878159
                  Validated:
                  by 1000G,by cluster,by frequency,by hapmap
                  Global MAF:
                  G=0.0996/499
                  HGVS:
                  NC_000004.11:g.106799316T>G, NC_000004.12:g.105878159T>G, XR_244687.1:n.345+17620A>C
                  14.
                  15.

                  rs10498230 [Homo sapiens]
                    TAATTTAATTTTAATTTGACCTGAA[C/T]AATTTGACATACATCTACATGTACA
                    Chromosome:
                    2:228637787
                    Validated:
                    by 1000G,by cluster,by frequency,by hapmap
                    Global MAF:
                    T=0.0905/453
                    HGVS:
                    NC_000002.11:g.229502503C>T, NC_000002.12:g.228637787C>T, XR_241422.1:n.261+106856G>A
                    16.
                    17.

                    rs8034191 [Homo sapiens]
                      CCCAATGTGGTATAAGTTTTCTGTT[C/T]AGAAAGGCCCTGACAGATAGTAACT
                      Chromosome:
                      15:78513681
                      Gene:
                      HYKK (GeneView)
                      Functional Consequence:
                      intron variant
                      Validated:
                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                      Global MAF:
                      C=0.1889/946
                      HGVS:
                      NC_000015.10:g.78513681T>C, NC_000015.9:g.78806023T>C, NM_001013619.3:c.337+256T>C, NM_001083612.1:c.337+256T>C, XM_011521231.2:c.337+256T>C, XM_017021922.1:c.337+256T>C, XR_243078.1:n.432+256T>C, XR_243078.4:n.432+256T>C
                      18.

                      rs7776375 [Homo sapiens]
                        TCAAATTAATGATCCCCCCCAACAC[A/G]GGTACCAAAATCCCATTTCTCTTCC
                        Chromosome:
                        6:142455927
                        Validated:
                        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                        Global MAF:
                        G=0.4337/2172
                        HGVS:
                        NC_000006.11:g.142777064A>G, NC_000006.12:g.142455927A>G
                        19.

                        rs7735184 [Homo sapiens]
                          attgctaaaactggaaagcaaccga[G/T]aaatttttagtaggtgaatggataa
                          Chromosome:
                          5:148464829
                          Gene:
                          HTR4 (GeneView) LOC107986462 (GeneView)
                          Functional Consequence:
                          intron variant
                          Validated:
                          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                          Global MAF:
                          T=0.4237/2122
                          HGVS:
                          NC_000005.10:g.148464829G>T, NC_000005.9:g.147844392G>T, NG_029052.1:g.194348C>A, NM_001040169.2:c.1077-13557C>A, NM_199453.3:c.*15+1021C>A, XR_001742935.1:n.679-4091G>T
                          20.

                          rs7710510 [Homo sapiens]
                            actggagtcccttggcttgcagctg[C/T]gatactccaatgtcacgtgttttcc
                            Chromosome:
                            5:7427176
                            Gene:
                            ADCY2 (GeneView)
                            Functional Consequence:
                            intron variant
                            Validated:
                            by 1000G,by cluster,by frequency,by hapmap
                            Global MAF:
                            T=0.3187/1596
                            HGVS:
                            NC_000005.10:g.7427176T>C, NC_000005.9:g.7427289T>C, NG_046913.1:g.35947T>C, NM_020546.2:c.408+12406T>C, XM_011513942.2:c.408+12406T>C, XR_001741973.1:n.422+12406T>C, XR_001741974.1:n.422+12406T>C, XR_427657.2:n.422+12406T>C

                            Display Settings:

                            Format
                            Items per page
                            Sort by

                            Send to:

                            Choose Destination

                            Supplemental Content

                            Find related data

                            Recent activity

                            Your browsing activity is empty.

                            Activity recording is turned off.

                            Turn recording back on

                            See more...
                            Support Center