Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 5

4.

rs199474711 [Homo sapiens]
    CAACAGCCACTGCTCATGATGGAGG[C/T]CATCAAGAAAAAGATGCAGATGCTG
    Chromosome:
    1:154192008
    Gene:
    TPM3 (GeneView)
    Functional Consequence:
    missense,nc transcript variant
    Allele Origin:
    T(germline)/C(germline)
    Clinical significance:
    Pathogenic
    Validated:
    by cluster
    HGVS:
    NC_000001.10:g.154164484G>A, NC_000001.11:g.154192008G>A, NG_008621.1:g.5126C>T, NM_152263.2:c.11C>T, NM_152263.3:c.11C>T, NP_689476.2:p.Ala4Val, NR_103460.1:n.60C>T

    Display Settings:

    Format
    Sort by

    Send to:

    Choose Destination

    Supplemental Content

    Find related data

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center