Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 12

2.

rs12315175 [Homo sapiens]
    TGCATAACATAAATATCTTTTGTAG[C/T]AGAAGAGCCTGTAAGTCACTTTCCC
    Chromosome:
    12:107105494
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    C=0.1783/893
    HGVS:
    NC_000012.11:g.107499272T>C, NC_000012.12:g.107105494T>C
    3.

    rs11133373 [Homo sapiens]
      TTTGTTTGGGATTATTTTTTTCTTT[C/G/T]CTACGGAGGCAAGAGTAAAACCTGA
      Chromosome:
      4:55349464
      Gene:
      SRD5A3 (GeneView)
      Functional Consequence:
      intron variant,upstream variant 2KB
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      G=0.3087/1546
      HGVS:
      NC_000004.11:g.56215631C>G, NC_000004.12:g.55349464C>G, NC_000004.12:g.55349464C>T, NG_028230.1:g.8244C>G, NG_028230.1:g.8244C>T, NM_024592.4:c.221+2907C>G, NM_024592.4:c.221+2907C>T, XM_005265766.1:c.221+2907C>G, XM_005265766.3:c.221+2907C>G, XM_005265766.3:c.221+2907C>T, XM_005265767.1:c.221+2907C>G, XM_005265767.3:c.221+2907C>G, XM_005265767.3:c.221+2907C>T, XM_017008601.1:c.-1665C>G, XM_017008601.1:c.-1665C>T
      5.

      rs7602358 [Homo sapiens]
        aaagaAAAGAAAAACAAAACACATG[G/T]GGCCCAAAAGCTCTGTAGGTGATGA
        Chromosome:
        2:238147187
        Gene:
        KLHL30 (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by 1000G,by cluster,by frequency,by hapmap
        Global MAF:
        G=0.1344/673
        HGVS:
        NC_000002.11:g.239055828G>T, NC_000002.12:g.238147187G>T, NM_198582.3:c.1151-647G>T, XM_005246076.1:c.1166-647G>T
        6.

        rs2292912 [Homo sapiens]
          ATATCACTCAGGCTGTGGGGAAACC[A/C/G]TCAGGGACAGAATCTCACTGTCTTC
          Chromosome:
          11:45856137
          Gene:
          CRY2 (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
          Global MAF:
          G=0.4996/2502
          HGVS:
          NC_000011.10:g.45856137C>G, NC_000011.10:g.45856137C>T, NC_000011.9:g.45877688C>G, NC_000011.9:g.45877688C>T, NM_001127457.2:c.141+47C>G, NM_001127457.2:c.141+47C>T, NM_021117.3:c.387+47C>G, NM_021117.3:c.387+47C>T
          7.

          rs2289591 [Homo sapiens]
            TGCCCAGTCTAGGACTGGATTGTTG[G/T]GGGGTGGGTCTTAAGGGAGGTGTTT
            Chromosome:
            17:8144692
            Gene:
            MIR6883 (GeneView) PER1 (GeneView)
            Functional Consequence:
            downstream variant 500B,intron variant
            Validated:
            by 1000G,by cluster,by frequency,by hapmap
            Global MAF:
            A=0.0937/469
            HGVS:
            NC_000017.10:g.8048010C>A, NC_000017.11:g.8144692C>A, NM_002616.2:c.2461+59G>T, NR_106943.1:n.380G>T, XM_005256689.1:c.2461+59G>T, XM_005256690.1:c.2281+59G>T
            8.

            rs1534891 [Homo sapiens]
              AGAGCCATGGCCTTCCCTATCCTAC[C/T]GTGATGAAAGCCTAGCCTGCCCGTG
              Chromosome:
              22:38299094
              Gene:
              CSNK1E (GeneView) LOC400927-CSNK1E (GeneView)
              Functional Consequence:
              intron variant
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
              Global MAF:
              T=0.1068/535
              HGVS:
              NC_000022.10:g.38695099T>C, NC_000022.11:g.38299094T>C, NG_016707.1:g.23991A>G, NM_001289912.1:c.737-160A>G, NM_001894.4:c.737-160A>G, NM_152221.2:c.737-160A>G, XM_005261343.1:c.737-160A>G, XM_005261344.1:c.737-160A>G, XM_005261345.1:c.737-160A>G, XM_005261346.1:c.737-160A>G
              12.

              rs885747 [Homo sapiens]
                GGAGGTGAGAAAAGGTGTGGGAAGC[A/C/G/T]GGGTCAAGCCATCTAACCTGCCCTC
                Chromosome:
                17:8147419
                Gene:
                PER1 (GeneView)
                Functional Consequence:
                intron variant
                Validated:
                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                Global MAF:
                C=0.3458/1732
                HGVS:
                NC_000017.10:g.8050737G>C, NC_000017.11:g.8147419G>A, NC_000017.11:g.8147419G>C, NC_000017.11:g.8147419G>T, NM_002616.2:c.1498-38C>A, NM_002616.2:c.1498-38C>G, NM_002616.2:c.1498-38C>T, XM_005256689.1:c.1498-38C>A, XM_005256689.1:c.1498-38C>G, XM_005256689.1:c.1498-38C>T, XM_005256690.1:c.1498-38C>A, XM_005256690.1:c.1498-38C>G, XM_005256690.1:c.1498-38C>T

                Display Settings:

                Format
                Items per page
                Sort by

                Send to:

                Choose Destination

                Supplemental Content

                Find related data

                Recent activity

                Your browsing activity is empty.

                Activity recording is turned off.

                Turn recording back on

                See more...
                Support Center