Display Settings:

Format

Send to:

Choose Destination

Links from PubMed

1.

rs4986790 [Homo sapiens]
    GCATACTTAGACTACTACCTCGATG[A/G]TATTATTGACTTATTTAATTGTTTG
    Chromosome:
    9:117713024
    Gene:
    TLR4 (GeneView)
    Functional Consequence:
    missense
    Allele Origin:
    G(germline)/A(germline)
    Clinical significance:
    Benign
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    G=0.0599/300
    HGVS:
    NC_000009.11:g.120475302A>G, NC_000009.12:g.117713024A>G, NG_011475.1:g.13843A>G, NM_003266.3:c.776A>G, NM_138554.3:c.896A>G, NM_138554.4:c.896A>G, NM_138557.2:c.296A>G, NP_003257.1:p.Asp259Gly, NP_612564.1:p.Asp299Gly, NP_612567.1:p.Asp99Gly, XM_005252182.1:c.890A>G, XP_005252239.1:p.Asp297Gly

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center