Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 3

1.

rs4845617 [Homo sapiens]
    GGAAGTCGCACTGACACTGAGCCGG[A/C/G]CCAGAGGGAGAGGAGCCGAGCGCGG
    Chromosome:
    1:154405422
    Gene:
    IL6R (GeneView) LOC101928101 (GeneView)
    Functional Consequence:
    intron variant,utr variant 5 prime
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency
    Global MAF:
    A=0.3804/1905
    HGVS:
    CM000663.2:g.154405422G>A, CM000663.2:g.154405422G>C, NC_000001.10:g.154377898G>A, NC_000001.11:g.154405422G>A, NC_000001.11:g.154405422G>C, NG_012087.1:g.5230G>A, NG_012087.1:g.5230G>C, NM_000565.3:c.-208G>A, NM_000565.3:c.-208G>C, NM_001206866.1:c.-208G>A, NM_001206866.1:c.-208G>C, NM_181359.2:c.-208G>A, NM_181359.2:c.-208G>C, NR_147855.1:n.126+1017C>G, NR_147855.1:n.126+1017C>T, XR_241131.1:n.385+1017C>T
    2.

    rs4553185 [Homo sapiens]
      TTCTAGCCCTGTGGCGTAGTTGAAC[A/C/T]AAATTAATCATTCTTAAATACTTGG
      Chromosome:
      1:154438479
      Gene:
      IL6R (GeneView)
      Functional Consequence:
      downstream variant 500B,intron variant
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      T=0.4998/2503
      HGVS:
      CM000663.2:g.154438479C>A, CM000663.2:g.154438479C>T, NC_000001.10:g.154410955C>T, NC_000001.11:g.154438479C>A, NC_000001.11:g.154438479C>T, NG_012087.1:g.38287C>A, NG_012087.1:g.38287C>T, NM_000565.3:c.949+2369C>A, NM_000565.3:c.949+2369C>T, NM_001206866.1:c.*935C>A, NM_001206866.1:c.*935C>T, NM_181359.2:c.949+2369C>A, NM_181359.2:c.949+2369C>T
      3.

      rs4379670 [Homo sapiens]
        ATCAGCCGTGTAACCATGGACCCAA[A/T]ATTTACCAGACCACAAAACTTTTCT
        Chromosome:
        1:154467389
        Gene:
        IL6R (GeneView)
        Functional Consequence:
        utr variant 3 prime
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        T=0.2041/1022
        HGVS:
        CM000663.2:g.154467389T>A, NC_000001.10:g.154439865T>A, NC_000001.11:g.154467389T>A, NG_012087.1:g.67197T>A, NM_000565.3:c.*2009T>A, NM_181359.2:c.*2224T>A

        Display Settings:

        Format
        Sort by

        Send to:

        Choose Destination

        Supplemental Content

        Find related data

        Recent activity

        Your browsing activity is empty.

        Activity recording is turned off.

        Turn recording back on

        See more...
        Support Center