Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 1 to 20 of 24

6.

rs7974040 [Homo sapiens]
    AACCTGGGGAGCAGGTGGGCCGTGG[C/T]CCCCAGGCTTTCCAGCCCTACCCCT
    Chromosome:
    12:109233896
    Gene:
    ACACB (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency
    Global MAF:
    T=0.1452/727
    HGVS:
    CM000674.2:g.109233896C>T, NC_000012.11:g.109671701C>T, NC_000012.12:g.109233896C>T, NG_046907.1:g.127713C>T, NM_001093.3:c.4240-42C>T, XR_001748678.1:n.4998-42C>T, XR_001748679.1:n.3885-42C>T, XR_243000.1:n.4532-42C>T, XR_243001.1:n.4537-42C>T, XR_944530.2:n.4998-42C>T, XR_944531.2:n.4997-42C>T, XR_944532.2:n.4998-42C>T
    8.
    12.

    rs2268391 [Homo sapiens]
      CAGATGCACAGGCAGCAGGCACCTG[A/G]TCACACACCTCGCAGGCCACAGAGC
      Chromosome:
      12:109197441
      Gene:
      ACACB (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      T=0.3822/1914
      HGVS:
      CM000674.2:g.109197441C>T, NC_000012.11:g.109635246C>T, NC_000012.12:g.109197441C>T, NG_046907.1:g.91258C>T, NM_001093.3:c.2627+288C>T, XR_001748678.1:n.3385+288C>T, XR_001748679.1:n.2272+288C>T, XR_243000.1:n.2919+288C>T, XR_243001.1:n.2924+288C>T, XR_944530.2:n.3385+288C>T, XR_944531.2:n.3384+288C>T, XR_944532.2:n.3385+288C>T
      14.

      rs2268384 [Homo sapiens]
        CTACGGTTATGTAAGTACCATAGGG[A/G]AAGCTGGGTGAAGGGTACTTGGAAA
        Chromosome:
        12:109251588
        Gene:
        ACACB (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        T=0.2973/1489
        HGVS:
        CM000674.2:g.109251588C>T, NC_000012.11:g.109689393C>T, NC_000012.12:g.109251588C>T, NG_046907.1:g.145405C>T, NM_001093.3:c.5791-458C>T, XR_001748678.1:n.6451-458C>T, XR_001748679.1:n.5338-458C>T, XR_243000.1:n.6083-458C>T, XR_243001.1:n.5990-458C>T, XR_944530.2:n.6549-458C>T, XR_944531.2:n.6548-458C>T, XR_944532.2:n.6549-458C>T
        16.

        rs2239608 [Homo sapiens]
          TGTGCATCAGAAAGCCAGCATGGTG[G/T]GGGGGATCAAACATAAGGTCACATG
          Chromosome:
          12:109208917
          Gene:
          ACACB (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 1000G,by cluster,by frequency
          Global MAF:
          C=0.3546/1776
          HGVS:
          CM000674.2:g.109208917A>C, NC_000012.11:g.109646722A>C, NC_000012.12:g.109208917A>C, NG_046907.1:g.102734A>C, NM_001093.3:c.3061-248A>C, XR_001748678.1:n.3819-248A>C, XR_001748679.1:n.2706-248A>C, XR_243000.1:n.3353-248A>C, XR_243001.1:n.3358-248A>C, XR_944530.2:n.3819-248A>C, XR_944531.2:n.3818-248A>C, XR_944532.2:n.3819-248A>C
          19.

          rs1266175 [Homo sapiens]
            TAGCTCAGGAAGACCCCGGAACACC[A/G]CCTGGGTAAAGACTCCTGCTTTTCT
            Chromosome:
            17:37111115
            Gene:
            ACACA (GeneView)
            Functional Consequence:
            intron variant
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency,by submitter
            Global MAF:
            A=0.3193/1599
            HGVS:
            CM000679.2:g.37111115A>G, NC_000017.10:g.35468050A>G, NC_000017.11:g.37111115A>G, NG_023295.1:g.303853T>C, NG_023295.2:g.300697T>C, NM_198834.1:c.6565+416T>C, NM_198834.2:c.6565+416T>C, NM_198836.1:c.6454+416T>C, NM_198836.2:c.6454+416T>C, NM_198837.1:c.6280+416T>C, NM_198838.1:c.6220+416T>C, NM_198839.1:c.6454+416T>C, NM_198839.2:c.6454+416T>C, NT_187614.1:g.1347115A>G
            20.

            rs741402 [Homo sapiens]
              CAGGGGTTGGGAGAAAGAGAGTGTT[C/T]CAGTTCAGAGGGAACCCAGTGCGAA
              Chromosome:
              12:109146550
              Gene:
              ACACB (GeneView)
              Functional Consequence:
              intron variant
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
              Global MAF:
              G=0.3670/1838
              HGVS:
              CM000674.2:g.109146550A>G, NC_000012.11:g.109584355A>G, NC_000012.12:g.109146550A>G, NG_046907.1:g.40367A>G, NM_001093.3:c.653+6492A>G, XR_001748678.1:n.1411+6492A>G, XR_243000.1:n.945+6492A>G, XR_243001.1:n.950+6492A>G, XR_944530.2:n.1411+6492A>G, XR_944531.2:n.1410+6492A>G, XR_944532.2:n.1411+6492A>G

              Display Settings:

              Format
              Items per page
              Sort by

              Send to:

              Choose Destination

              Supplemental Content

              Find related data

              Recent activity

              Your browsing activity is empty.

              Activity recording is turned off.

              Turn recording back on

              See more...
              Support Center