Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 15

1.

rs17508595 [Homo sapiens]
    CTTATTACAGGTAATTGAACAGAAG[C/G]TAGTCAATTAGATTATATACGCACG
    Chromosome:
    2:184618381
    Gene:
    ZNF804A (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by cluster,by frequency
    Global MAF:
    G=0.2252/1128
    HGVS:
    CM000664.2:g.184618381C>G, NC_000002.11:g.185483108C>G, NC_000002.12:g.184618381C>G, NG_046950.1:g.25016C>G, NM_194250.1:c.111+19311C>G
    2.

    rs13393273 [Homo sapiens]
      AGATCTTTGTGCAACAGCTAGCATT[A/G]TATAAGCTAAATTTGATAAAGTAAG
      Chromosome:
      2:184612950
      Gene:
      ZNF804A (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by cluster,by frequency
      Global MAF:
      G=0.3534/1770
      HGVS:
      CM000664.2:g.184612950A>G, NC_000002.11:g.185477677A>G, NC_000002.12:g.184612950A>G, NG_046950.1:g.19585A>G, NM_194250.1:c.111+13880A>G
      3.

      rs12693385 [Homo sapiens]
        TCTTTGTATCAACATCTTCATAACC[C/T]GTAATTGTTTTAAAAATTCATTAGT
        Chromosome:
        2:184642502
        Gene:
        ZNF804A (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by 1000G,by cluster,by frequency
        Global MAF:
        T=0.4834/2421
        HGVS:
        CM000664.2:g.184642502C>T, NC_000002.11:g.185507229C>T, NC_000002.12:g.184642502C>T, NG_046950.1:g.49137C>T, NM_194250.1:c.111+43432C>T
        4.

        rs12613195 [Homo sapiens]
          GTTCTATATTACATTTTTCAGAGCA[C/G]TAGCAATGATTCTATAAAAGACTGA
          Chromosome:
          2:184624494
          Gene:
          ZNF804A (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 1000G,by cluster,by frequency,by hapmap
          Global MAF:
          G=0.2714/1359
          HGVS:
          CM000664.2:g.184624494C>G, NC_000002.11:g.185489221C>G, NC_000002.12:g.184624494C>G, NG_046950.1:g.31129C>G, NM_194250.1:c.111+25424C>G
          5.

          rs12477430 [Homo sapiens]
            TTAGTTCTTCAAAATGATATGAAAC[A/G]CATGAGTCAGAATCAGGCTGTTAAA
            Chromosome:
            2:184937636
            Gene:
            ZNF804A (GeneView)
            Functional Consequence:
            missense
            Validated:
            by 1000G,by cluster,by frequency,by hapmap
            Global MAF:
            A=0.2957/1481
            HGVS:
            CM000664.2:g.184937636A>G, NC_000002.11:g.185802363A>G, NC_000002.12:g.184937636A>G, NG_046950.1:g.344271A>G, NM_194250.1:c.2240A>G, NP_919226.1:p.His747Arg
            6.

            rs9922369 [Homo sapiens]
              AGGAGCTAGTGAACACTTTTGGGTT[A/G]AATACCGTGGGAAACAGGAACACTT
              Chromosome:
              16:53614570
              Gene:
              RPGRIP1L (GeneView)
              Functional Consequence:
              intron variant
              Validated:
              by 1000G,by cluster,by frequency
              Global MAF:
              A=0.1216/609
              HGVS:
              CM000678.2:g.53614570G>A, NC_000016.10:g.53614570G>A, NC_000016.9:g.53648482G>A, NG_008991.2:g.94290C>T, NM_001127897.3:c.3377-3519C>T, NM_001308334.2:c.3479-3519C>T, NM_001330538.1:c.3515-3519C>T, NM_015272.4:c.3617-3519C>T, XR_933260.2:n.3523-3519C>T
              7.

              rs7605689 [Homo sapiens]
                TCCTGCACTATCTTTCACGTTTTTG[C/T]CATATGTCCCTGTATGTCTTCTTTA
                Chromosome:
                2:184841129
                Gene:
                ZNF804A (GeneView)
                Functional Consequence:
                intron variant
                Validated:
                by 1000G,by 2hit 2allele,by cluster,by frequency
                Global MAF:
                C=0.2875/1440
                HGVS:
                CM000664.2:g.184841129T>C, NC_000002.11:g.185705856T>C, NC_000002.12:g.184841129T>C, NG_046950.1:g.247764T>C, NM_194250.1:c.112-25240T>C
                8.

                rs7603001 [Homo sapiens]
                  TTTTATGGTAAAAAAATATGTACTT[A/G/T]GAATTAGCTAGACTCAGTTTAGCTT
                  Chromosome:
                  2:184902089
                  Gene:
                  ZNF804A (GeneView)
                  Functional Consequence:
                  intron variant
                  Validated:
                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                  Global MAF:
                  G=0.4567/2287
                  HGVS:
                  CM000664.2:g.184902089A>G, CM000664.2:g.184902089A>T, NC_000002.11:g.185766816A>G, NC_000002.12:g.184902089A>G, NC_000002.12:g.184902089A>T, NG_010972.1:g.574T>A, NG_010972.1:g.574T>C, NG_046950.1:g.308724A>G, NG_046950.1:g.308724A>T, NM_194250.1:c.256-31514A>G, NM_194250.1:c.256-31514A>T
                  9.

                  rs7597593 [Homo sapiens]
                    ATTTATGAATTTAATTCATTAATGT[C/T]GTAAATAGTATTGCCCGAGAATTGG
                    Chromosome:
                    2:184668853
                    Gene:
                    ZNF804A (GeneView)
                    Functional Consequence:
                    intron variant
                    Validated:
                    by 1000G,by 2hit 2allele,by cluster,by frequency
                    Global MAF:
                    C=0.4984/2496
                    HGVS:
                    CM000664.2:g.184668853T>C, NC_000002.11:g.185533580T>C, NC_000002.12:g.184668853T>C, NG_046950.1:g.75488T>C, NM_194250.1:c.111+69783T>C
                    10.

                    rs6490121 [Homo sapiens]
                      GACTACTCTTTGCAACTGAAATGTA[A/G]ACAGAGATCAGAGAGCAGACTTATT
                      Chromosome:
                      12:117270390
                      Gene:
                      NOS1 (GeneView)
                      Functional Consequence:
                      intron variant
                      Validated:
                      by 1000G,by cluster,by frequency
                      Global MAF:
                      G=0.3704/1855
                      HGVS:
                      CM000674.2:g.117270390G>A, NC_000012.11:g.117708195G>A, NC_000012.12:g.117270390G>A, NG_011991.2:g.96388C>T, NM_000620.4:c.1839+1995C>T, NM_001204213.1:c.831+1995C>T, NM_001204214.1:c.831+1995C>T, NM_001204218.1:c.1839+1995C>T
                      11.

                      rs4667001 [Homo sapiens]
                        CAGTAGTTGTGATTCTGGAAAAAAT[A/G]AGAACACAGGTCAGAGGTATAAAAA
                        Chromosome:
                        2:184937020
                        Gene:
                        ZNF804A (GeneView)
                        Functional Consequence:
                        missense
                        Validated:
                        by 1000G,by 2hit 2allele,by cluster,by frequency
                        Global MAF:
                        A=0.4902/2455
                        HGVS:
                        CM000664.2:g.184937020G>A, NC_000002.11:g.185801747G>A, NC_000002.12:g.184937020G>A, NG_046950.1:g.343655G>A, NM_194250.1:c.1624G>A, NP_919226.1:p.Glu542Lys
                        12.

                        rs4129148 [Homo sapiens]
                          GCTGGAAAAAATGGCCAATGCAACT[C/G/T]GGTCTGAATTTCTCTCCTGGGTGTC
                          Chromosome:
                          Y:1029445
                          Validated:
                          by 1000G,by 2hit 2allele,by cluster,by frequency
                          Global MAF:
                          G=0.4475/2241
                          HGVS:
                          CM000685.2:g.1029445C>G, CM000685.2:g.1029445C>T, CM000686.2:g.1029445C>G, CM000686.2:g.1029445C>T, NC_000023.10:g.990180C>G, NC_000023.11:g.1029445C>G, NC_000023.11:g.1029445C>T, NC_000024.10:g.1029445C>G, NC_000024.10:g.1029445C>T, NC_000024.9:g.940180C>G, NW_003571064.2:g.186303C>G
                          13.

                          rs3931790 [Homo sapiens]
                            GTTCTATCTTTATAAGCCACTTATA[G/T]TCAATCTAGAGAAAGGTAAAATATA
                            Chromosome:
                            2:184898649
                            Gene:
                            ZNF804A (GeneView)
                            Functional Consequence:
                            intron variant
                            Validated:
                            by 1000G,by cluster,by frequency
                            Global MAF:
                            C=0.1508/755
                            HGVS:
                            CM000664.2:g.184898649A>C, NC_000002.11:g.185763376A>C, NC_000002.12:g.184898649A>C, NG_046950.1:g.305284A>C, NM_194250.1:c.255+32137A>C
                            14.

                            rs1480481 [Homo sapiens]
                              GCATTTTCTCATGGGTTTCCACCCC[C/G/T]GGTAAGTTAGATTAATGTAATTAAa
                              Chromosome:
                              2:184682735
                              Gene:
                              ZNF804A (GeneView)
                              Functional Consequence:
                              intron variant
                              Validated:
                              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                              Global MAF:
                              T=0.4858/2433
                              HGVS:
                              CM000664.2:g.184682735C>G, CM000664.2:g.184682735C>T, NC_000002.11:g.185547462C>T, NC_000002.12:g.184682735C>G, NC_000002.12:g.184682735C>T, NG_046950.1:g.89370C>G, NG_046950.1:g.89370C>T, NM_194250.1:c.111+83665C>G, NM_194250.1:c.111+83665C>T
                              15.

                              rs1344706 [Homo sapiens]
                                aacactgaaacaaagaatcaaaaac[A/G/T]atcagaatcaacttcttggatatct
                                Chromosome:
                                2:184913701
                                Gene:
                                ZNF804A (GeneView)
                                Functional Consequence:
                                intron variant
                                Validated:
                                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                Global MAF:
                                C=0.3045/1525
                                HGVS:
                                CM000664.2:g.184913701A>C, CM000664.2:g.184913701A>T, NC_000002.11:g.185778428A>C, NC_000002.12:g.184913701A>C, NC_000002.12:g.184913701A>T, NG_046950.1:g.320336A>C, NG_046950.1:g.320336A>T, NM_194250.1:c.256-19902A>C, NM_194250.1:c.256-19902A>T

                                Display Settings:

                                Format
                                Items per page
                                Sort by

                                Send to:

                                Choose Destination

                                Supplemental Content

                                Find related data

                                Recent activity

                                Your browsing activity is empty.

                                Activity recording is turned off.

                                Turn recording back on

                                See more...
                                Support Center