Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 19

1.

rs17035648 [Homo sapiens]
    TTAAGTTTTAGTTTGTAGTAGCAAT[A/G]AACTGCCCTCCTTTCATTGACTTGG
    Chromosome:
    4:157097028
    Gene:
    GLRB (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    G=0.1905/954
    HGVS:
    NC_000004.11:g.158018180A>G, NC_000004.12:g.157097028A>G, NG_015823.1:g.25904A>G, NM_000824.4:c.122+18882A>G, NM_001166060.1:c.122+18882A>G, NM_001166061.1:c.122+18882A>G, XM_005262934.1:c.74+18737A>G, XM_017008034.1:c.-173+12304A>G, XM_017008035.1:c.122+18882A>G, XR_001741207.1:n.324+18882A>G
    2.

    rs11766192 [Homo sapiens]
      TGTGGCTGCTCCTATGGCTCCTGAA[C/T]GTGAAGGTGTCTGGGCACCTGTGCT
      Chromosome:
      7:45609204
      Gene:
      ADCY1 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      T=0.2694/1349
      HGVS:
      NC_000007.13:g.45648803C>T, NC_000007.14:g.45609204C>T, NG_034198.1:g.40065C>T, NM_001281768.1:c.115-1175C>T, NM_021116.2:c.790-1175C>T, XM_005249584.1:c.790-1175C>T, XM_005249584.3:c.790-1175C>T, XM_005249585.1:c.790-1175C>T, XM_005249585.2:c.790-1175C>T
      3.

      rs11630259 [Homo sapiens]
        TGAGCGTTGTTTCTGTAACCAGTTT[C/T]ACTGAACCTCACAGATCCATTATAC
        Chromosome:
        15:98887719
        Gene:
        IGF1R (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        C=0.2234/1119
        HGVS:
        NC_000015.10:g.98887719T>C, NC_000015.9:g.99430948T>C, NG_009492.1:g.243188T>C, NM_000875.4:c.641-3606T>C, NM_001291858.1:c.641-3606T>C, XM_005254896.1:c.641-3606T>C, XM_005254897.1:c.278-3606T>C, XM_017022136.1:c.716-3606T>C, XM_017022137.1:c.716-3606T>C, XM_017022138.1:c.716-3606T>C, XM_017022139.1:c.278-3606T>C
        4.

        rs10482979 [Homo sapiens]
          AGATCAAAGTGCATTTGCTCCCATA[C/T]ACTGTTGAAACCTCTGTATTGAACT
          Chromosome:
          21:26943963
          Gene:
          ADAMTS5 (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 1000G,by cluster,by frequency,by hapmap
          Global MAF:
          C=0.1026/514
          HGVS:
          NC_000021.8:g.28316282T>C, NC_000021.9:g.26943963T>C, NM_007038.4:c.1238-416A>G, XM_011529448.2:c.1238-9214A>G
          5.

          rs9593921 [Homo sapiens]
            ACACATTTTTATATATAGTGAGTTC[A/C]TGTTCATTCATTGCTAATTAGTTTA
            Chromosome:
            13:36206363
            Gene:
            CCDC169-SOHLH2 (GeneView) SOHLH2 (GeneView)
            Functional Consequence:
            intron variant
            Validated:
            by 1000G,by cluster,by frequency,by hapmap
            Global MAF:
            C=0.0232/116
            HGVS:
            NC_000013.10:g.36780500A>C, NC_000013.11:g.36206363A>C, NG_033786.1:g.13253T>G, NM_001198910.1:c.280-4270T>G, NM_001282147.1:c.49-4270T>G, NM_017826.2:c.49-4270T>G, XM_005266437.1:c.49-4270T>G
            7.

            rs4612931 [Homo sapiens]
              TGTTCTGCCTGCTGAAGATTAGCAC[G/T]GTGGTGGGAGTGTATATCCAGGTTG
              Chromosome:
              13:93771943
              Gene:
              GPC6 (GeneView)
              Functional Consequence:
              intron variant
              Validated:
              by 1000G,by cluster,by frequency
              Global MAF:
              G=0.1454/728
              HGVS:
              NC_000013.10:g.94424196T>G, NC_000013.11:g.93771943T>G, NG_011880.1:g.550119T>G, NM_005708.3:c.320-58211T>G, NM_005708.4:c.320-58211T>G, XM_005254017.1:c.110-58211T>G, XM_011521044.2:c.110-58211T>G, XM_017020298.1:c.110-58211T>G, XM_017020299.1:c.110-58211T>G, XM_017020300.1:c.110-58211T>G
              8.

              rs3021274 [Homo sapiens]
                TTTACTGCATGTGCTAAGCATACTT[C/T]AGTGGAAAGCAGATACCTAAAACAC
                Chromosome:
                22:39999080
                Gene:
                FAM83F (GeneView)
                Functional Consequence:
                intron variant
                Validated:
                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                Global MAF:
                T=0.4772/2390
                HGVS:
                NC_000022.10:g.40395084T>C, NC_000022.11:g.39999080T>C, NM_138435.2:c.489+3549T>C
                9.
                11.

                rs2245803 [Homo sapiens]
                  GCTGTCTTCCTCATCATGGCTTTGA[A/C/G/T]GTTTTCCACTGCAGCCCCCTCCCTA
                  Chromosome:
                  11:102625267
                  Gene:
                  LOC101928477 (GeneView) MMP20 (GeneView)
                  Functional Consequence:
                  intron variant,missense,upstream variant 2KB
                  Clinical significance:
                  Benign
                  Validated:
                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                  Global MAF:
                  T=0.3235/1620
                  HGVS:
                  NC_000011.10:g.102625267T>G, NC_000011.9:g.102495998T>G, NG_012151.1:g.5066A>C, NM_004771.3:c.53A>C, NP_004762.2:p.Lys18Thr, XR_001748340.1:n.1444+17815T>G, XR_947958.2:n.-1477T>G
                  12.

                  rs1784424 [Homo sapiens]
                    CGGAAAGTATTCCTGGGGAAGCCCA[A/C]TCTGCCCCATGCCCCCCATCACAAG
                    Chromosome:
                    11:102606646
                    Gene:
                    LOC101928477 (GeneView) MMP20 (GeneView)
                    Functional Consequence:
                    intron variant,missense
                    Clinical significance:
                    Benign
                    Validated:
                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                    Global MAF:
                    T=0.4199/2103
                    HGVS:
                    NC_000011.10:g.102606646G>T, NC_000011.9:g.102477377G>T, NG_012151.1:g.23687C>A, NM_004771.3:c.842C>A, NP_004762.2:p.Thr281Asn, XR_001748340.1:n.1192+41G>T
                    13.

                    rs1784423 [Homo sapiens]
                      TTTTGAATCCTAGGACCTCGGAAAG[A/C/T]ATTCCTGGGGAAGCCCACTCTGCCC
                      Chromosome:
                      11:102606664
                      Gene:
                      LOC101928477 (GeneView) MMP20 (GeneView)
                      Functional Consequence:
                      intron variant,missense
                      Clinical significance:
                      Benign
                      Validated:
                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                      Global MAF:
                      G=0.4199/2103
                      HGVS:
                      NC_000011.10:g.102606664A>G, NC_000011.9:g.102477395A>G, NG_012151.1:g.23669T>C, NM_004771.3:c.824T>C, NP_004762.2:p.Val275Ala, XR_001748340.1:n.1192+59A>G
                      14.

                      rs1784418 [Homo sapiens]
                        TTGAGCTATTTGCTATCCTTTCTGT[A/G/T]GGCACAGTCCTTTCATTTGGGACCC
                        Chromosome:
                        11:102613665
                        Gene:
                        LOC101928477 (GeneView) MMP20 (GeneView)
                        Functional Consequence:
                        intron variant
                        Validated:
                        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                        Global MAF:
                        T=0.4223/2115
                        HGVS:
                        NC_000011.10:g.102613665C>A, NC_000011.10:g.102613665C>T, NC_000011.9:g.102484396C>T, NG_012151.1:g.16668G>A, NG_012151.1:g.16668G>T, NM_004771.3:c.375-1762G>A, NM_004771.3:c.375-1762G>T, XR_001748340.1:n.1444+6213C>A, XR_001748340.1:n.1444+6213C>T
                        15.

                        rs1711437 [Homo sapiens]
                          ACATTTCAGTTGCTCTTTGTCCTCA[A/G]GTTGGGTATGAAATGCCACCCTACA
                          Chromosome:
                          11:102594495
                          Gene:
                          MMP20 (GeneView)
                          Functional Consequence:
                          intron variant
                          Validated:
                          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                          Global MAF:
                          T=0.3966/1986
                          HGVS:
                          NC_000011.10:g.102594495C>T, NC_000011.9:g.102465226C>T, NG_012151.1:g.35838G>A, NM_004771.3:c.1090+126G>A
                          16.

                          rs1004792 [Homo sapiens]
                            ATGCTGCCTCCCCTGCAGAGCATCC[A/G]tttctttctttccgtttttggtaga
                            Chromosome:
                            16:3044260
                            Gene:
                            MMP25 (GeneView)
                            Functional Consequence:
                            upstream variant 2KB
                            Validated:
                            by 1000G,by cluster,by frequency,by hapmap,by submitter
                            Global MAF:
                            A=0.1713/858
                            HGVS:
                            NC_000016.10:g.3044260G>A, NC_000016.9:g.3094261G>A, XM_017023561.1:c.-2658G>A
                            17.

                            rs705704 [Homo sapiens]
                              CTCTTCGTAATCCTACACCTACCTA[A/G]TAGAAGGACTGTCAGAGAAATGAGC
                              Chromosome:
                              12:56041628
                              Gene:
                              LOC105369780 (GeneView) RPS26 (GeneView)
                              Functional Consequence:
                              nc transcript variant,upstream variant 2KB
                              Validated:
                              by 1000G,by cluster,by frequency,by hapmap
                              Global MAF:
                              A=0.2061/1032
                              HGVS:
                              NC_000012.11:g.56435412G>A, NC_000012.12:g.56041628G>A, NG_023201.1:g.4727G>A, NM_001029.3:c.-539G>A, XR_944989.2:n.134C>T, XR_944990.2:n.134C>T
                              19.

                              rs8643 [Homo sapiens]
                                TGGTTTCCTTTGAGACTAAAATAGC[A/G]TTGAGGGAAATGAAATTGCTGGACT
                                Chromosome:
                                6:7882840
                                Gene:
                                BLOC1S5-TXNDC5 (GeneView) TXNDC5 (GeneView)
                                Functional Consequence:
                                nc transcript variant,utr variant 3 prime
                                Validated:
                                by 1000G,by cluster,by frequency,by hapmap
                                Global MAF:
                                T=0.0972/487
                                HGVS:
                                NC_000006.11:g.7883073C>T, NC_000006.12:g.7882840C>T, NM_001145549.2:c.*304G>A, NM_030810.3:c.*304G>A, NR_037616.1:n.1762G>A

                                Display Settings:

                                Format
                                Items per page
                                Sort by

                                Send to:

                                Choose Destination

                                Supplemental Content

                                Find related data

                                Recent activity

                                Your browsing activity is empty.

                                Activity recording is turned off.

                                Turn recording back on

                                See more...
                                Support Center