Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 1 to 20 of 29

1.

rs11894266 [Homo sapiens]
    TCACCATACTTCACCATATACTTCT[C/T]CACTGCAAGTGGAGATGTACTACTA
    Chromosome:
    2:169780132
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
    Global MAF:
    T=0.4217/2112
    HGVS:
    CM000664.2:g.169780132C>T, NC_000002.11:g.170636642C>T
    2.

    rs11827375 [Homo sapiens]
      ACAACAGACACCATTCCTCCACGTG[A/G]GGAACAAACAATAAGGAAGGTGAGT
      Chromosome:
      11:76597228
      Validated:
      by 1000G,by cluster,by frequency,by hapmap
      Global MAF:
      A=0.0937/469
      HGVS:
      CM000673.2:g.76597228G>A, NC_000011.9:g.76308272G>A
      3.

      rs11136000 [Homo sapiens]
        ACCAAAGCCACACCAGCTATCAAAA[C/T]TCTCTAACGGGCCCTTGCCACTTGA
        Chromosome:
        8:27607002
        Gene:
        CLU (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        T=0.3782/1894
        HGVS:
        CM000670.2:g.27607002T>C, NC_000008.10:g.27464519T>C, NC_000008.11:g.27607002T>C, NG_027845.1:g.12809A>G, NM_001831.3:c.247-478A>G, NR_038335.1:n.568-478A>G, NR_045494.1:n.427-478A>G
        4.

        rs10501927 [Homo sapiens]
          AAACGAGAATACAAAAGACCGATTA[G/T]ACTAGTCAGGTTCTGTTTCTTAAAT
          Chromosome:
          11:99886997
          Gene:
          CNTN5 (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 1000G,by cluster,by frequency
          Global MAF:
          G=0.1080/541
          HGVS:
          CM000673.2:g.99886997T>G, NC_000011.10:g.99886997T>G, NC_000011.9:g.99757729T>G, NG_047156.1:g.871022T>G, NM_001243270.1:c.578-29057T>G, NM_001243271.1:c.578-29057T>G, NM_014361.3:c.578-29057T>G, NM_175566.2:c.356-29057T>G, XR_001747909.1:n.1082-29057T>G
          5.

          rs9446432 [Homo sapiens]
            TGAaagagacacacatacggagaaa[A/C/T]agcaaactatgcacccaacgggggc
            Chromosome:
            6:71647057
            Validated:
            by 1000G,by cluster,by frequency
            Global MAF:
            C=0.1715/859
            HGVS:
            CM000668.2:g.71647057T>A, CM000668.2:g.71647057T>C, NC_000006.11:g.72356760T>C
            6.

            rs9384428 [Homo sapiens]
              atctcctccaggttcatctgtattg[C/T]tgtaaatggcaagattggctttgtt
              Chromosome:
              6:156178397
              Gene:
              LOC101928923 (GeneView)
              Functional Consequence:
              intron variant
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
              Global MAF:
              C=0.2935/1470
              HGVS:
              CM000668.2:g.156178397C>T, NC_000006.11:g.156499531C>T, NC_000006.12:g.156178397C>T, XR_001744423.1:n.247-9903G>A, XR_245619.1:n.155+73923G>A
              7.

              rs8106922 [Homo sapiens]
                CCCTTCTCCACGTGTCTTCCTCTCC[A/G]GGGCTGCACCCTAGGAGATTGCTCG
                Chromosome:
                19:44898409
                Gene:
                TOMM40 (GeneView)
                Functional Consequence:
                intron variant
                Validated:
                by 1000G,by cluster,by frequency
                Global MAF:
                G=0.2973/1489
                HGVS:
                CM000681.2:g.44898409A>G, NC_000019.10:g.44898409A>G, NC_000019.9:g.45401666A>G, NG_042854.1:g.12190A>G, NM_001128916.1:c.644-2321A>G, NM_001128917.1:c.644-2321A>G, NM_006114.2:c.644-2321A>G
                8.

                rs7561528 [Homo sapiens]
                  GGCCATAGTTTCAAGTAAACATGTC[A/G]CAGTGAAGTTTGTTGTAGAGTCTTC
                  Chromosome:
                  2:127132061
                  Gene:
                  LOC105373605 (GeneView)
                  Functional Consequence:
                  intron variant
                  Validated:
                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                  Global MAF:
                  A=0.2001/1002
                  HGVS:
                  CM000664.2:g.127132061G>A, NC_000002.11:g.127889637G>A, NC_000002.12:g.127132061G>A, XR_923310.2:n.440-1177G>A, XR_923311.2:n.492-1177G>A
                  9.

                  rs6701713 [Homo sapiens]
                    gataatgcctgcagcccaacagatg[A/G/T]cagtgtgcttaacagctctgtcaat
                    Chromosome:
                    1:207612944
                    Gene:
                    CR1 (GeneView)
                    Functional Consequence:
                    intron variant
                    Validated:
                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                    Global MAF:
                    A=0.2484/1244
                    HGVS:
                    CM000663.2:g.207612944A>G, CM000663.2:g.207612944A>T, NC_000001.10:g.207786289A>G, NC_000001.11:g.207612944A>G, NC_000001.11:g.207612944A>T, NG_007481.1:g.121817A>G, NG_007481.1:g.121817A>T, NM_000573.3:c.5225+903A>G, NM_000573.3:c.5225+903A>T, NM_000651.4:c.6575+903A>G, NM_000651.4:c.6575+903A>T
                    10.

                    rs5984894 [Homo sapiens]
                      CATAATGTACAATGGATAATCATTC[A/G]TAGCATTATATTGAGATCCAAATAT
                      Chromosome:
                      X:92138738
                      Gene:
                      PCDH11X (GeneView)
                      Functional Consequence:
                      intron variant
                      Validated:
                      by 1000G,by 2hit 2allele,by cluster,by frequency
                      Global MAF:
                      G=0.4154/1568
                      HGVS:
                      CM000685.2:g.92138738A>G, NC_000023.10:g.91393737A>G, NC_000023.11:g.92138738A>G, NG_016251.1:g.364478A>G, NM_001168360.1:c.3034-62637A>G, NM_001168361.1:c.3034-62637A>G, NM_001168362.1:c.3034-248997A>G, NM_001168363.1:c.3034-62637A>G, NM_032968.4:c.3034-62637A>G, NM_032969.4:c.3034-62637A>G
                      11.

                      rs3851179 [Homo sapiens]
                        GCAAACAATACACACTTCAGTAAAT[A/G]TTATCTATCACAACTATTATATGGT
                        Chromosome:
                        11:86157598
                        Validated:
                        by 1000G,by 2hit 2allele,by cluster,by frequency
                        Global MAF:
                        T=0.3149/1577
                        HGVS:
                        CM000673.2:g.86157598T>C, NC_000011.9:g.85868640T>C
                        12.

                        rs3818361 [Homo sapiens]
                          GTTAGATATGGGGCAATTTCCTTTG[C/T]TATATCTTATGCTTACCAGAGGGCT
                          Chromosome:
                          1:207611623
                          Gene:
                          CR1 (GeneView)
                          Functional Consequence:
                          intron variant
                          Validated:
                          by 1000G,by cluster,by frequency,by hapmap
                          Global MAF:
                          A=0.2486/1245
                          HGVS:
                          CM000663.2:g.207611623A>G, NC_000001.10:g.207784968A>G, NC_000001.11:g.207611623A>G, NG_007481.1:g.120496A>G, NM_000573.3:c.4946-54A>G, NM_000651.4:c.6296-54A>G
                          13.

                          rs2075650 [Homo sapiens]
                            GAGATGAGAGTTGGTGTGGGGTTGG[A/G]GTGGAGTGTGACAGCGTTTCTCTTC
                            Chromosome:
                            19:44892362
                            Gene:
                            TOMM40 (GeneView)
                            Functional Consequence:
                            intron variant
                            Validated:
                            by 1000G,by cluster,by frequency
                            Global MAF:
                            G=0.1194/598
                            HGVS:
                            CM000681.2:g.44892362A>G, NC_000019.10:g.44892362A>G, NC_000019.9:g.45395619A>G, NG_042854.1:g.6143A>G, NM_001128916.1:c.275-31A>G, NM_001128917.1:c.275-31A>G, NM_006114.2:c.275-31A>G
                            14.

                            rs1539053 [Homo sapiens]
                              GCACTAACTGCCTAGATTAACCCCA[C/T]GGTCCAGGATGCGCCAGCCATGGCA
                              Chromosome:
                              1:57634035
                              Gene:
                              DAB1 (GeneView)
                              Functional Consequence:
                              intron variant
                              Validated:
                              by 1000G,by 2hit 2allele,by cluster,by frequency,by submitter
                              Global MAF:
                              G=0.4888/2448
                              HGVS:
                              CM000663.2:g.57634035A>G, NC_000001.10:g.58099707A>G, NC_000001.11:g.57634035A>G, NG_046914.1:g.621505T>C, NG_046914.2:g.621513T>C, NM_001353980.1:c.-137+15557T>C, NM_021080.3:c.-137+15557T>C, NM_021080.4:c.-137+15557T>C
                              15.

                              rs1408077 [Homo sapiens]
                                CTTATAGAGTCATCACCCCAAAACA[G/T]TGGAAATGACAATAATAATCCAATA
                                Chromosome:
                                1:207630796
                                Gene:
                                CR1 (GeneView)
                                Functional Consequence:
                                intron variant
                                Validated:
                                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                                Global MAF:
                                A=0.1412/707
                                HGVS:
                                CM000663.2:g.207630796A>C, NC_000001.10:g.207804141A>C, NC_000001.11:g.207630796A>C, NG_007481.1:g.139669A>C, NM_000573.3:c.6107+175A>C, NM_000651.4:c.7457+175A>C
                                16.

                                rs1157242 [Homo sapiens]
                                  GAGTCTCTGACTCTACGACAGGGCA[A/G]AGTTTAGCTTCTCCTATAGATAAGG
                                  Chromosome:
                                  8:37181847
                                  Validated:
                                  by 1000G,by cluster,by frequency,by submitter
                                  Global MAF:
                                  T=0.0573/287
                                  HGVS:
                                  CM000670.2:g.37181847C>T, NC_000008.10:g.37039365C>T
                                  17.

                                  rs744373 [Homo sapiens]
                                    CACCAGGGACAGGCAGGTCTGAGGC[C/T]CTCAGAGGCTGCCCATGATGCTGCC
                                    Chromosome:
                                    2:127137039
                                    Validated:
                                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                    Global MAF:
                                    G=0.3580/1793
                                    HGVS:
                                    CM000664.2:g.127137039A>G, NC_000002.11:g.127894615A>G
                                    18.

                                    rs676309 [Homo sapiens]
                                      aatataatggtgagataggtataga[A/G]tagactgtctcagttcaaaagagag
                                      Chromosome:
                                      11:60234100
                                      Gene:
                                      MS4A4E (GeneView)
                                      Functional Consequence:
                                      intron variant
                                      Validated:
                                      by 1000G,by cluster,by frequency,by hapmap
                                      Global MAF:
                                      C=0.3624/1815
                                      HGVS:
                                      CM000673.2:g.60234100T>C, NC_000011.10:g.60234100T>C, NC_000011.9:g.60001573T>C, NM_001351235.1:c.-89-4029A>G, XR_950143.2:n.168-4029A>G, XR_950144.2:n.168-4029A>G
                                      19.

                                      rs662196 [Homo sapiens]
                                        TTCTGGTTTGGGCATCTGGGGGAAA[A/G]CCAGGTTTATGTAAATCAAAGGGGA
                                        Chromosome:
                                        11:60175284
                                        Gene:
                                        MS4A6A (GeneView)
                                        Functional Consequence:
                                        downstream variant 500B,intron variant
                                        Validated:
                                        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                        Global MAF:
                                        C=0.4565/2286
                                        HGVS:
                                        CM000673.2:g.60175284C>T, NC_000011.10:g.60175284C>T, NC_000011.9:g.59942757C>T, NG_033978.1:g.14383G>A, NM_001247999.1:c.633+118G>A, NM_001330275.1:c.633+118G>A, NM_022349.3:c.549+118G>A, NM_152851.2:c.445+222G>A, NM_152852.2:c.549+118G>A
                                        20.

                                        rs610932 [Homo sapiens]
                                          AAATGTTTCCCAGAAAACTAGACAG[A/C]ATGATCATTCAATGGATCACAGTGA
                                          Chromosome:
                                          11:60171834
                                          Gene:
                                          MS4A6A (GeneView)
                                          Functional Consequence:
                                          downstream variant 500B,intron variant,utr variant 3 prime
                                          Validated:
                                          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                                          Global MAF:
                                          T=0.4535/2271
                                          HGVS:
                                          CM000673.2:g.60171834T>G, NC_000011.10:g.60171834T>G, NC_000011.9:g.59939307T>G, NG_033978.1:g.17833A>C, NM_001330275.1:c.*149+175A>C, NM_152851.2:c.*430A>C, NM_152852.2:c.*324A>C

                                          Display Settings:

                                          Format
                                          Items per page
                                          Sort by

                                          Send to:

                                          Choose Destination

                                          Supplemental Content

                                          Find related data

                                          Recent activity

                                          Your browsing activity is empty.

                                          Activity recording is turned off.

                                          Turn recording back on

                                          See more...
                                          Support Center