Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 12

1.

rs1990760 [Homo sapiens]
    TAGTCGGCACACTTCTTTTGCAGTG[C/T]TTTGTTTTCTCTTACAATGTAAAGT
    Chromosome:
    2:162267541
    Gene:
    IFIH1 (GeneView)
    Functional Consequence:
    missense
    Clinical significance:
    Benign
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by submitter
    Global MAF:
    T=0.3566/1786
    HGVS:
    CM000664.2:g.162267541C>T, NC_000002.11:g.163124051C>T, NC_000002.12:g.162267541C>T, NG_011495.1:g.55989G>A, NM_022168.3:c.2836G>A, NP_071451.2:p.Ala946Thr
    2.

    rs1543851 [Homo sapiens]
      TTTTCTTTCTGTGTTTCCTGTGGAT[A/G/T]TGTTTTTCTTCATTTGCTCTGTGTC
      Chromosome:
      7:65341359
      Gene:
      LOC105375334 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency
      Global MAF:
      G=0.2903/1454
      HGVS:
      CM000669.2:g.65341359A>G, CM000669.2:g.65341359A>T, NC_000007.13:g.64806272A>G, NC_000007.14:g.65341359A>G, NC_000007.14:g.65341359A>T, XR_927613.2:n.838+2743A>G, XR_927613.2:n.838+2743A>T
      4.

      rs1004446 [Homo sapiens]
        GAAAGGCCATTGTGGAGAGGGTTCT[C/T]CTTTAGGGCTGCACAAAGCCACTGA
        Chromosome:
        11:2148913
        Gene:
        IGF2-AS (GeneView) IGF2 (GeneView) INS-IGF2 (GeneView)
        Functional Consequence:
        downstream variant 500B,intron variant
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
        Global MAF:
        A=0.3305/1655
        HGVS:
        CM000673.2:g.2148913G>A, NC_000011.10:g.2148913G>A, NC_000011.9:g.2170143G>A, NG_008849.1:g.5691C>T, NG_050578.1:g.17297C>T, NM_001007139.5:c.-249+213C>T, NM_001042376.2:c.407+213C>T, NR_003512.3:n.466+213C>T, NR_028043.2:n.2315G>A, NR_028044.1:n.2842+247G>A, NR_133657.1:n.2204G>A
        6.

        rs942434 [Homo sapiens]
          GCTTCGAAGAAGCCCATCAGCTCTC[C/T]GTATTTTTGTCAGTTGTTGTGTCCT
          Chromosome:
          10:7195045
          Gene:
          SFMBT2 (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
          Global MAF:
          T=0.2504/1254
          HGVS:
          CM000672.2:g.7195045C>T, NC_000010.10:g.7237007C>T, NC_000010.11:g.7195045C>T, NM_001018039.1:c.1698+2503G>A, NM_001029880.2:c.1698+2503G>A
          8.

          rs876498 [Homo sapiens]
            CATATAGCCTCTGACAATTTTTAAG[C/T]AGCTTTTAATGACTACTCAAATAAA
            Chromosome:
            21:42421718
            Gene:
            UBASH3A (GeneView)
            Functional Consequence:
            intron variant
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency,by submitter
            Global MAF:
            A=0.3890/1948
            HGVS:
            CM000683.2:g.42421718G>A, NC_000021.8:g.43841827G>A, NC_000021.9:g.42421718G>A, NG_029750.1:g.22857G>A, NM_001001895.2:c.932+3109G>A, NM_001243467.1:c.932+3109G>A, NM_018961.3:c.1046+3109G>A, XR_244316.1:n.1016+3109G>A
            9.

            rs737280 [Homo sapiens]
              GCCTGGACCTCGAGGAAACACAGGC[A/G]GGAGGAGGCATGAAGGCGCTGAAGG
              Chromosome:
              12:111757172
              Gene:
              ACAD10 (GeneView)
              Functional Consequence:
              downstream variant 500B
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
              Global MAF:
              T=0.3704/1855
              HGVS:
              CM000674.2:g.111757172T>C, NC_000012.11:g.112194976T>C, NC_000012.12:g.111757172T>C, NM_001136538.1:c.*699T>C, NM_025247.5:c.*699T>C
              10.

              rs714027 [Homo sapiens]
                CAACCTATTAAAGAATTTTCCCCCA[A/G]TGCTCTAGCAAATTGCCTGGCACAT
                Chromosome:
                22:30181782
                Gene:
                HORMAD2 (GeneView)
                Functional Consequence:
                intron variant
                Validated:
                by 1000G,by 2hit 2allele,by cluster,by frequency,by submitter
                Global MAF:
                G=0.4411/2209
                HGVS:
                CM000684.2:g.30181782A>G, NC_000022.10:g.30577771A>G, NC_000022.11:g.30181782A>G

                Display Settings:

                Format
                Items per page
                Sort by

                Send to:

                Choose Destination

                Supplemental Content

                Find related data

                Recent activity

                Your browsing activity is empty.

                Activity recording is turned off.

                Turn recording back on

                See more...
                Support Center