Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 1 to 20 of 29

1.

rs12950743 [Homo sapiens]
    TTCTTTCAGGGTGTTGTCTCCCAGT[C/T]GACACTGTAACAGATTTTAGTGAGC
    Chromosome:
    17:39892980
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
    Global MAF:
    C=0.3800/1903
    HGVS:
    NC_000017.10:g.38049233T>C, NC_000017.11:g.39892980T>C
    2.

    rs12936231 [Homo sapiens]
      AGTTACTTACATTAGCCCCCAGATG[C/G]AGTGAAACCATCAAGTATAAATTAT
      Chromosome:
      17:39872867
      Gene:
      ZPBP2 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      G=0.4335/2171
      HGVS:
      NC_000017.10:g.38029120C>G, NC_000017.11:g.39872867C>G, NM_198844.2:c.560-177C>G, NM_199321.2:c.626-177C>G, XM_005257031.1:c.626-177C>G, XM_005257032.1:c.272-177C>G, XM_011524298.1:c.626-177C>G
      3.

      rs12926231 [Homo sapiens]
        aaattaacatttcaagctctcacat[A/G]tagtgagaaaatgtgatatttgttt
        Chromosome:
        16:16902859
        Validated:
        by 1000G,by cluster,by frequency
        Global MAF:
        G=0.0763/382
        HGVS:
        NC_000016.9:g.16996716A>G, NT_187607.1:g.2563817A>G
        4.
        5.

        rs12150079 [Homo sapiens]
          ACCCCCAACCAAATTGTAGGACGTT[A/G]TCTTTATGAGCCTGGCATTCAGTAG
          Chromosome:
          17:39869164
          Gene:
          ZPBP2 (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 1000G,by cluster,by frequency,by hapmap
          Global MAF:
          A=0.1863/933
          HGVS:
          NC_000017.10:g.38025417G>A, NC_000017.11:g.39869164G>A, NG_029104.2:g.25C>T, NM_198844.2:c.52+758G>A, NM_199321.2:c.118+550G>A, XM_005257031.1:c.118+550G>A, XM_005257032.1:c.52+758G>A, XM_011524298.1:c.118+550G>A
          6.

          rs11557467 [Homo sapiens]
            AGAGTGCTGAAGAAAATCTTGGATA[G/T]TCTAATTTCTGATTTGTCATGCCAT
            Chromosome:
            17:39872381
            Gene:
            ZPBP2 (GeneView)
            Functional Consequence:
            missense
            Validated:
            by 1000G,by cluster,by frequency,by hapmap
            Global MAF:
            T=0.3796/1901
            HGVS:
            NC_000017.10:g.38028634G>T, NC_000017.11:g.39872381G>T, NM_198844.2:c.452G>T, NM_199321.2:c.518G>T, NP_942141.2:p.Ser151Ile, NP_955353.1:p.Ser173Ile, XM_005257031.1:c.518G>T, XM_005257032.1:c.164G>T, XM_011524298.1:c.518G>T, XP_005257088.1:p.Ser173Ile, XP_005257089.1:p.Ser55Ile, XP_011522600.1:p.Ser173Ile
            7.

            rs9901146 [Homo sapiens]
              ACAACACTTCTACCCACACTGATCA[A/G]TTTCTTCCATAAATGTATTGTCTGC
              Chromosome:
              17:39887090
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
              Global MAF:
              A=0.3802/1904
              HGVS:
              NC_000017.10:g.38043343G>A, NC_000017.11:g.39887090G>A
              10.

              rs8076131 [Homo sapiens]
                ACTGAAGGCCTAATGTGGGACATCT[A/G]CTCTTAAGCTCTTCCCATCAGGAGG
                Chromosome:
                17:39924659
                Gene:
                ORMDL3 (GeneView)
                Functional Consequence:
                intron variant
                Validated:
                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                Global MAF:
                G=0.3123/1564
                HGVS:
                NC_000017.10:g.38080912G>A, NC_000017.11:g.39924659G>A, NM_001320801.1:c.-23+96C>T, NM_001320802.1:c.-17-439C>T, NM_001320803.1:c.-22-434C>T, NM_139280.3:c.-22-434C>T, XM_005257825.1:c.33-434C>T, XM_005257826.1:c.33-434C>T, XM_005257827.1:c.-17-439C>T, XM_017025345.1:c.33-434C>T, XM_017025346.1:c.-22-434C>T, XM_017025347.1:c.-17-439C>T, XM_017025348.1:c.-17-439C>T
                11.

                rs8067378 [Homo sapiens]
                  AAAAAATATTTGTAACGTTATAAAT[A/G]GGGAAAAACGTTTATATCACTGCCA
                  Chromosome:
                  17:39895095
                  Validated:
                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                  Global MAF:
                  G=0.4315/2161
                  HGVS:
                  NC_000017.10:g.38051348A>G, NC_000017.11:g.39895095A>G
                  12.

                  rs7359623 [Homo sapiens]
                    GGCACACAGGTTAATGACTAGGTTA[C/T]CCTGAAATAGGCTAATGCATTATTC
                    Chromosome:
                    17:39893336
                    Validated:
                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                    Global MAF:
                    T=0.3706/1856
                    HGVS:
                    NC_000017.10:g.38049589C>T, NC_000017.11:g.39893336C>T
                    17.
                    18.

                    rs4795397 [Homo sapiens]
                      TCATCCATCCCTACAGAAAAGGCCA[A/G]TCGGGCTCCATCCCTACAGAAAAGG
                      Chromosome:
                      17:39867492
                      Gene:
                      ZPBP2 (GeneView)
                      Functional Consequence:
                      upstream variant 2KB
                      Validated:
                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                      Global MAF:
                      G=0.3137/1571
                      HGVS:
                      NC_000017.10:g.38023745A>G, NC_000017.11:g.39867492A>G, NG_029104.2:g.1697T>C, NM_198844.2:c.-863A>G, NM_199321.2:c.-863A>G, XM_005257031.1:c.-863A>G, XM_005257032.1:c.-863A>G, XM_011524298.1:c.-863A>G

                      Display Settings:

                      Format
                      Items per page
                      Sort by

                      Send to:

                      Choose Destination

                      Supplemental Content

                      Find related data

                      Recent activity

                      Your browsing activity is empty.

                      Activity recording is turned off.

                      Turn recording back on

                      See more...
                      Support Center