Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 1 to 20 of 30

1.

rs2812415 [Homo sapiens]
    ATGGCAGGGTCTCTCCCACCTTCAG[C/G/T]TCTCTTTCTGGATTAGTCAGATGTC
    Chromosome:
    10:77647212
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
    Global MAF:
    C=0.2105/1054
    HGVS:
    NC_000010.10:g.79406970C>G, NC_000010.11:g.77647212C>A, NC_000010.11:g.77647212C>G
    3.

    rs2326689 [Homo sapiens]
      AAACATGTAACCCTGGGTGAACCCG[A/G]ACTTCAAAGTGTTTTGGGGGAGTGC
      Chromosome:
      6:6021645
      Validated:
      by 1000G,by cluster,by frequency,by hapmap,by submitter
      Global MAF:
      A=0.1867/935
      HGVS:
      NC_000006.11:g.6021878G>A, NC_000006.12:g.6021645G>A
      5.

      rs2244688 [Homo sapiens]
        GTTCAGTAAAGGTCCTAGTAGAAGG[C/T]GCTTACCATATTTCAGCAGAATGCT
        Chromosome:
        10:77647022
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        T=0.2107/1055
        HGVS:
        NC_000010.10:g.79406780T>C, NC_000010.11:g.77647022T>C
        8.

        rs2133507 [Homo sapiens]
          TAAAAAATAATCAGCTCAAAATAAA[C/G]CAAGGAAAGAAAGGAAAAGAAACAG
          Chromosome:
          4:25168420
          Gene:
          SEPSECS-AS1 (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
          Global MAF:
          C=0.2035/1019
          HGVS:
          NC_000004.11:g.25170042C>G, NC_000004.12:g.25168420C>G, NR_037934.1:n.82+7667C>G
          9.

          rs1902946 [Homo sapiens]
            TAGGTAACACAGGTAAGTGGTACAG[C/T]TATCATTAGAAACCAGGCTTACTGA
            Chromosome:
            6:6368345
            Gene:
            LY86-AS1 (GeneView)
            Functional Consequence:
            intron variant
            Validated:
            by 1000G,by cluster,by frequency,by hapmap,by submitter
            Global MAF:
            T=0.2035/1019
            HGVS:
            NC_000006.11:g.6368578C>T, NC_000006.12:g.6368345C>T, NR_026970.1:n.672+657G>A
            10.

            rs1878001 [Homo sapiens]
              AAGAAAGTCCCTATGTACGGTGTTC[A/G]TCAATTCCTATGGTATAAATATTCC
              Chromosome:
              10:77618800
              Gene:
              KCNMA1 (GeneView)
              Functional Consequence:
              intron variant
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
              Global MAF:
              T=0.3099/1552
              HGVS:
              NC_000010.10:g.79378558C>T, NC_000010.11:g.77618800C>T, NG_012270.1:g.24020G>A, NM_001014797.2:c.378+18465G>A, NM_001161352.1:c.378+18465G>A, NM_001161353.1:c.378+18465G>A, NM_001271518.1:c.378+18465G>A, NM_001271519.1:c.378+18465G>A, NM_001322829.1:c.378+18465G>A, NM_001322830.1:c.378+18465G>A, NM_001322832.1:c.378+18465G>A, NM_001322835.1:c.378+18465G>A, NM_001322836.1:c.378+18465G>A, NM_001322837.1:c.378+18465G>A, NM_002247.3:c.378+18465G>A, XM_005269773.1:c.378+18465G>A, XM_005269774.1:c.378+18465G>A, XM_005269775.1:c.378+18465G>A, XM_005269776.1:c.378+18465G>A, XM_005269776.3:c.378+18465G>A, XM_005269777.1:c.378+18465G>A, XM_005269778.1:c.378+18465G>A, XM_005269779.1:c.378+18465G>A, XM_005269780.1:c.378+18465G>A, XM_005269781.1:c.378+18465G>A, XM_005269781.2:c.378+18465G>A, XM_005269782.1:c.378+18465G>A, XM_005269783.1:c.378+18465G>A, XM_005269784.1:c.378+18465G>A, XM_005269785.1:c.378+18465G>A, XM_005269786.1:c.378+18465G>A, XM_005269787.1:c.378+18465G>A, XM_005269787.3:c.378+18465G>A, XM_005269788.1:c.378+18465G>A, XM_005269789.1:c.378+18465G>A, XM_005269789.2:c.378+18465G>A, XM_005269790.1:c.378+18465G>A, XM_005269791.1:c.378+18465G>A, XM_005269792.1:c.378+18465G>A, XM_005269792.2:c.378+18465G>A, XM_005269793.1:c.378+18465G>A, XM_005269794.1:c.378+18465G>A, XM_005269795.1:c.378+18465G>A, XM_005269796.1:c.378+18465G>A, XM_005269796.2:c.378+18465G>A, XM_005269797.1:c.378+18465G>A, XM_005269798.1:c.378+18465G>A, XM_005269799.1:c.378+18465G>A, XM_005269800.1:c.378+18465G>A, XM_005269801.1:c.378+18465G>A, XM_005269802.1:c.378+18465G>A, XM_005269804.1:c.378+18465G>A, XM_006717826.2:c.378+18465G>A, XM_011539773.1:c.378+18465G>A, XM_011539774.1:c.378+18465G>A, XM_011539775.1:c.378+18465G>A, XM_011539776.1:c.378+18465G>A, XM_011539777.1:c.378+18465G>A, XM_011539778.2:c.378+18465G>A, XM_011539779.1:c.378+18465G>A, XM_011539780.1:c.378+18465G>A, XM_011539781.2:c.378+18465G>A, XM_011539782.2:c.378+18465G>A, XM_011539783.1:c.378+18465G>A, XM_011539784.1:c.378+18465G>A, XM_011539785.1:c.378+18465G>A, XM_017016207.1:c.378+18465G>A, XM_017016208.1:c.378+18465G>A, XM_017016209.1:c.378+18465G>A, XM_017016210.1:c.378+18465G>A, XM_017016211.1:c.378+18465G>A, XM_017016212.1:c.378+18465G>A, XM_017016213.1:c.378+18465G>A, XM_017016214.1:c.378+18465G>A, XM_017016215.1:c.378+18465G>A, XM_017016216.1:c.378+18465G>A, XM_017016217.1:c.378+18465G>A, XM_017016219.1:c.378+18465G>A, XM_017016220.1:c.378+18465G>A, XM_017016222.1:c.378+18465G>A
              11.

              rs1437803 [Homo sapiens]
                ATATGCCTTTTTTGGCAAAGCACCT[A/G]TTTGAATCTTTTGCCTAGTTTTACT
                Chromosome:
                10:79043121
                Gene:
                ZMIZ1-AS1 (GeneView)
                Functional Consequence:
                intron variant
                Validated:
                by 1000G,by cluster,by frequency,by hapmap
                Global MAF:
                T=0.1865/934
                HGVS:
                NC_000010.10:g.80802878C>T, NC_000010.11:g.79043121C>T, NR_015429.1:n.273+22626G>A, NR_024429.1:n.432+5653G>A, NR_024431.2:n.565+5653G>A
                12.

                rs1402031 [Homo sapiens]
                  GAGAAAGAACATGACACTCTCAGGA[C/T]GCTGCAAGTTGTGGGGTGCAGCTGG
                  Chromosome:
                  4:25593908
                  Validated:
                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                  Global MAF:
                  T=0.1008/505
                  HGVS:
                  NC_000004.11:g.25595530T>C, NC_000004.12:g.25593908T>C
                  13.

                  rs1378946 [Homo sapiens]
                    AACATGACAGCTGGTCTTTCCTTGG[C/T]TAACTTCTTCGAGTGTCCGAGGACA
                    Chromosome:
                    4:25771828
                    Gene:
                    SEL1L3 (GeneView)
                    Functional Consequence:
                    intron variant
                    Validated:
                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                    Global MAF:
                    T=0.2810/1407
                    HGVS:
                    NC_000004.11:g.25773450C>T, NC_000004.12:g.25771828C>T, NM_001297592.1:c.2565-3998G>A, NM_001297594.1:c.2211-3998G>A, NM_015187.4:c.2670-3998G>A, XM_005248143.1:c.2670-3998G>A, XM_011513819.2:c.2670-3998G>A, XM_017007923.1:c.1999-3998G>A, XR_001741182.1:n.2503-3998G>A, XR_001741183.1:n.2503-3998G>A
                    14.

                    rs1378943 [Homo sapiens]
                      ATAATGATACATCTTAATAATCAAT[A/C]CTTTGGCTGCTTGCTGTGAATTACA
                      Chromosome:
                      4:25771449
                      Gene:
                      SEL1L3 (GeneView)
                      Functional Consequence:
                      intron variant
                      Validated:
                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                      Global MAF:
                      C=0.3694/1850
                      HGVS:
                      NC_000004.11:g.25773071C>A, NC_000004.12:g.25771449C>A, NM_001297592.1:c.2565-3619G>T, NM_001297594.1:c.2211-3619G>T, NM_015187.4:c.2670-3619G>T, XM_005248143.1:c.2670-3619G>T, XM_011513819.2:c.2670-3619G>T, XM_017007923.1:c.1999-3619G>T, XR_001741182.1:n.2503-3619G>T, XR_001741183.1:n.2503-3619G>T
                      15.

                      rs1369752 [Homo sapiens]
                        aacatgAGATTTACTTATCTGATCT[A/G]TACGTAACCAATCTCTCGTTCTGGC
                        Chromosome:
                        10:78488998
                        Validated:
                        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                        Global MAF:
                        C=0.3744/1875
                        HGVS:
                        NC_000010.10:g.80248755T>C, NC_000010.11:g.78488998T>C
                        16.

                        rs1343697 [Homo sapiens]
                          TTTAAAACACCCAGATTCAAACGGA[C/G]CTCTGCAACTTTCAAGTTGCTTGAC
                          Chromosome:
                          7:133268228
                          Gene:
                          EXOC4 (GeneView)
                          Functional Consequence:
                          intron variant
                          Validated:
                          by 1000G,by cluster,by frequency,by hapmap,by submitter
                          Global MAF:
                          G=0.0974/488
                          HGVS:
                          NC_000007.13:g.132952983C>G, NC_000007.14:g.133268228C>G, NG_047176.1:g.20162C>G, NM_001037126.1:c.87-6754C>G, NM_021807.3:c.87-6754C>G, XM_005250520.1:c.-217-6754C>G, XM_005250523.1:c.87-6754C>G, XM_005250523.4:c.87-6754C>G, XM_017012495.1:c.87-6754C>G, XR_001744845.1:n.106-6754C>G
                          17.

                          rs1112267 [Homo sapiens]
                            TCTAGTAGACTTCCAATTAAAACCT[C/T]GGTGGTGAAGATTTAGCAGGAAGAC
                            Chromosome:
                            6:4928153
                            Gene:
                            CDYL (GeneView)
                            Functional Consequence:
                            intron variant
                            Validated:
                            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                            Global MAF:
                            A=0.1446/724
                            HGVS:
                            NC_000006.11:g.4928387A>G, NC_000006.12:g.4928153A>G, NM_001143970.1:c.296-7362A>G, NM_001143971.1:c.296-7362A>G, NM_004824.3:c.692-7362A>G, NR_026590.1:n.985-7362A>G, XM_011514997.2:c.692-7428A>G
                            18.

                            rs1073158 [Homo sapiens]
                              TTTTGAAGGCCATTCTGGGTTTTCT[C/T]GTCCATTTCTTCACACCCTAGGGTG
                              Chromosome:
                              7:133781255
                              Gene:
                              EXOC4 (GeneView)
                              Functional Consequence:
                              intron variant
                              Validated:
                              by 1000G,by cluster,by frequency,by hapmap
                              Global MAF:
                              C=0.1040/521
                              HGVS:
                              NC_000007.13:g.133466008C>T, NC_000007.14:g.133781255C>T, NG_047176.1:g.533189C>T, NM_021807.3:c.1515-36070C>T, XM_005250520.1:c.1212-36070C>T, XM_005250521.1:c.345-36070C>T, XM_005250522.1:c.111-36070C>T, XM_017012494.1:c.345-36070C>T, XR_001744845.1:n.1534-36070C>T
                              19.

                              rs958408 [Homo sapiens]
                                GATCATTAATGATAATGGATAATGA[C/T]AATGGCTGGAATAGAGGTGCTTTCA
                                Chromosome:
                                7:133456164
                                Gene:
                                EXOC4 (GeneView)
                                Functional Consequence:
                                intron variant
                                Validated:
                                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                                Global MAF:
                                A=0.1759/881
                                HGVS:
                                NC_000007.13:g.133140918A>G, NC_000007.14:g.133456164A>G, NG_047176.1:g.208098A>G, NM_001037126.1:c.1183-19164A>G, NM_021807.3:c.1183-19164A>G, XM_005250520.1:c.880-19164A>G, XM_005250523.1:c.1183-19164A>G, XM_005250523.4:c.1183-19164A>G, XM_017012495.1:c.1183-19164A>G, XR_001744845.1:n.1202-19164A>G
                                20.

                                rs958404 [Homo sapiens]
                                  TCTGGATTCAATACAAATCAGGTAA[G/T]GAATACAGGTGTGTCCCTCTTTGAA
                                  Chromosome:
                                  7:133912433
                                  Gene:
                                  EXOC4 (GeneView)
                                  Functional Consequence:
                                  intron variant
                                  Validated:
                                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                                  Global MAF:
                                  A=0.4607/2307
                                  HGVS:
                                  NC_000007.13:g.133597186A>C, NC_000007.14:g.133912433A>C, NG_047176.1:g.664367A>C, NM_021807.3:c.1872-5150A>C, XM_005250520.1:c.1569-5150A>C, XM_005250521.1:c.702-5150A>C, XM_005250522.1:c.468-5150A>C, XM_017012494.1:c.702-5150A>C, XR_001744845.1:n.1891-5150A>C

                                  Display Settings:

                                  Format
                                  Items per page
                                  Sort by

                                  Send to:

                                  Choose Destination

                                  Supplemental Content

                                  Find related data

                                  Recent activity

                                  Your browsing activity is empty.

                                  Activity recording is turned off.

                                  Turn recording back on

                                  See more...
                                  Support Center