Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 11

1.

rs16901979 [Homo sapiens]
    GTGTTAATGATTTAGCATTACTTAT[A/C]TCTGGCAAATGGTATTTTTGAGATA
    Chromosome:
    8:127112671
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    A=0.2119/1061
    HGVS:
    NC_000008.10:g.128124916C>A, NC_000008.11:g.127112671C>A
    2.

    rs13281615 [Homo sapiens]
      GTAACTATGAATCTCATCAAAAGAA[A/G]GCAGAACGCAGATATTCTGAGTAGG
      Chromosome:
      8:127343372
      Gene:
      CASC21 (GeneView) CASC8 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      G=0.4912/2460
      HGVS:
      NC_000008.10:g.128355618A>G, NC_000008.11:g.127343372A>G, NR_117099.1:n.457+3937A>G, NR_117099.1:n.457+3938A>G, NR_117100.1:n.1177-53312T>C, NR_117100.1:n.1177-53313T>C
      3.

      rs13262164 [Homo sapiens]
        GTTGTGGAGACCAAGGCTTTATCAT[C/T]AGATGAAGCCTCCAGGTAGCAGGCT
        Chromosome:
        8:142679754
        Gene:
        PSCA (GeneView)
        Functional Consequence:
        intron variant,upstream variant 2KB
        Validated:
        by 1000G,by cluster,by frequency
        Global MAF:
        T=0.1835/919
        HGVS:
        NC_000008.10:g.143761172C>T, NC_000008.11:g.142679754C>T, NG_011722.3:g.14447C>T, NM_005672.4:c.-785C>T, NR_033343.1:n.262-1573C>T, NW_003871066.2:g.49887C>T
        4.

        rs10505483 [Homo sapiens]
          CCTCTGTTCTAAGGCTCATGGCACC[A/G]TTGTAAGCCCAGGGCCCTATGCTGA
          Chromosome:
          8:127112950
          Validated:
          by 1000G,by cluster,by frequency,by hapmap
          Global MAF:
          T=0.2117/1060
          HGVS:
          NC_000008.10:g.128125195C>T, NC_000008.11:g.127112950C>T
          5.

          rs9642880 [Homo sapiens]
            GCAAAGGCTGGAGTTAGGAGAACCC[G/T]TGGTTGATGGCTTTGTTAATTATTA
            Chromosome:
            8:127705823
            Gene:
            CASC11 (GeneView)
            Functional Consequence:
            intron variant
            Validated:
            by 1000G,by cluster,by frequency,by hapmap
            Global MAF:
            G=0.4599/2303
            HGVS:
            NC_000008.10:g.128718068G>T, NC_000008.11:g.127705823G>T, NR_117102.1:n.366-2580C>A, XR_242431.1:n.141-13957C>A
            6.

            rs6983267 [Homo sapiens]
              GTCCTTTGAGCTCAGCAGATGAAAG[G/T]CACTGAGAAAAGTACAAAGAATTTT
              Chromosome:
              8:127401060
              Gene:
              CASC8 (GeneView) CCAT2 (GeneView)
              Functional Consequence:
              intron variant,nc transcript variant
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
              Global MAF:
              T=0.3902/1954
              HGVS:
              NC_000008.10:g.128413305G>T, NC_000008.11:g.127401060G>T, NR_109834.1:n.662G>T, NR_117100.1:n.1176+19769C>A
              7.

              rs6471587 [Homo sapiens]
                TTAAACATCTTCTGGTTGGCAATCG[C/G]TTGCAAGAGTTATCAATAGAAAGGA
                Chromosome:
                8:142679685
                Gene:
                PSCA (GeneView)
                Functional Consequence:
                intron variant,upstream variant 2KB
                Validated:
                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                Global MAF:
                G=0.0781/391
                HGVS:
                NC_000008.10:g.143761103C>G, NC_000008.11:g.142679685C>G, NG_011722.3:g.14378C>G, NM_005672.4:c.-854C>G, NR_033343.1:n.262-1642C>G, NW_003871066.2:g.49818C>G
                8.

                rs2976387 [Homo sapiens]
                  ACAGGGGCTGACCTGGAGCCCCGGG[A/G]GAAGCCCAAAGGCAGATTCCTGGTG
                  Chromosome:
                  8:142677946
                  Gene:
                  PSCA (GeneView)
                  Functional Consequence:
                  intron variant
                  Validated:
                  by 1000G,by cluster,by frequency
                  Global MAF:
                  A=0.3095/1550
                  HGVS:
                  NC_000008.10:g.143759364G>A, NC_000008.11:g.142677946G>A, NG_011722.3:g.12639G>A, NR_033343.1:n.262-3381G>A, NW_003871066.2:g.48079G>A
                  9.

                  rs2294008 [Homo sapiens]
                    CTCCACCACAGCCCACCAGTGACCA[C/T]GAAGGCTGTGCTGCTTGCCCTGTTG
                    Chromosome:
                    8:142680513
                    Gene:
                    PSCA (GeneView)
                    Functional Consequence:
                    intron variant,utr variant 5 prime
                    Validated:
                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                    Global MAF:
                    T=0.4052/2029
                    HGVS:
                    NC_000008.10:g.143761931C>T, NC_000008.11:g.142680513C>T, NG_011722.3:g.15206C>T, NM_005672.4:c.-26C>T, NR_033343.1:n.262-814C>T, NW_003871066.2:g.50646C>T
                    10.

                    rs1447295 [Homo sapiens]
                      AGTGCCATTGGGGAGGTATGTAAAA[A/C]GTGCTATGGAAAAAAAGCAACAGGA
                      Chromosome:
                      8:127472793
                      Gene:
                      CASC8 (GeneView)
                      Functional Consequence:
                      intron variant
                      Validated:
                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                      Global MAF:
                      A=0.1811/907
                      HGVS:
                      NC_000008.10:g.128485038A>C, NC_000008.11:g.127472793A>C, NR_024393.1:n.1041+6290T>G, NR_117100.1:n.1041+6290T>G
                      11.

                      rs710521 [Homo sapiens]
                        TATCAGTGCTTATTCATTTTTTAAG[A/G]GATTGAATGCACTAAGGCAAAAGTG
                        Chromosome:
                        3:189928144
                        Validated:
                        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                        Global MAF:
                        C=0.2037/1020
                        HGVS:
                        NC_000003.11:g.189645933T>C, NC_000003.12:g.189928144T>C

                        Display Settings:

                        Format
                        Items per page
                        Sort by

                        Send to:

                        Choose Destination

                        Supplemental Content

                        Find related data

                        Recent activity

                        Your browsing activity is empty.

                        Activity recording is turned off.

                        Turn recording back on

                        See more...
                        Support Center