Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 2

1.

rs11195419 [Homo sapiens]
    CACACATCCCCAGTTGTTGGTTTGG[A/C]CACTCTTGACCTGGAGCCATCTTCC
    Chromosome:
    10:111079610
    Gene:
    ADRA2A (GeneView)
    Functional Consequence:
    utr variant 3 prime
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency
    Global MAF:
    A=0.1813/908
    HGVS:
    CM000672.2:g.111079610C>A, NC_000010.10:g.112839368C>A, NC_000010.11:g.111079610C>A, NG_012020.1:g.7579C>A, NM_000681.3:c.*216C>A
    2.

    rs962369 [Homo sapiens]
      TAATGACTTTCATGCCATGGACTCA[A/G]CTCTCTTGGCAGTCTGGTAAAGCTT
      Chromosome:
      11:27712873
      Gene:
      BDNF (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by cluster,by frequency
      Global MAF:
      C=0.2169/1086
      HGVS:
      CM000673.2:g.27712873T>C, NC_000011.10:g.27712873T>C, NC_000011.9:g.27734420T>C, NG_011794.1:g.14186A>G, NM_001143805.1:c.-22+7771A>G, NM_001143806.1:c.-22+7556A>G, NM_001143807.1:c.-22+6638A>G, NM_170731.4:c.3+8539A>G, NM_170732.4:c.-22+7473A>G

      Supplemental Content

      Find related data

      Recent activity

      Your browsing activity is empty.

      Activity recording is turned off.

      Turn recording back on

      See more...
      Support Center