Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 15

1.

rs17402858 [Homo sapiens]
    AGGAATATGGATTCTGGTCCTCAGA[A/C/T]GAGAAGGAGCAGTTCCGAATTTACA
    Chromosome:
    1:43956950
    Gene:
    IPO13 (GeneView)
    Functional Consequence:
    missense,synonymous codon
    Validated:
    by 1000G,by cluster,by frequency
    Global MAF:
    T=0.0220/110
    HGVS:
    CM000663.2:g.43956950C>A, CM000663.2:g.43956950C>T, NC_000001.10:g.44422622C>T, NC_000001.11:g.43956950C>A, NC_000001.11:g.43956950C>T, NM_014652.3:c.1245C>A, NM_014652.3:c.1245C>T, NP_055467.3:p.Asp415, NP_055467.3:p.Asp415Glu
    2.

    rs7412307 [Homo sapiens]
      GTTTTTGACAGGAATAGTAGGCTTT[C/G]TAGGTAGAGGACTTGAGACTTTGGG
      Chromosome:
      1:43968192
      Gene:
      DPH2 (GeneView) IPO13 (GeneView)
      Functional Consequence:
      downstream variant 500B,upstream variant 2KB
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      C=0.4445/2226
      HGVS:
      CM000663.2:g.43968192C>G, NC_000001.10:g.44433864C>G, NC_000001.11:g.43968192C>G, NM_001039589.1:c.-1984C>G, NM_001319165.1:c.-2202C>G, NM_001319166.1:c.-1984C>G, NM_001319167.1:c.-2620C>G, NM_001319168.1:c.-2160C>G, NM_001319169.1:c.-2165C>G, NM_001319170.1:c.-2623C>G, NM_001319171.1:c.-2459C>G, NM_001384.4:c.-1984C>G, NM_014652.3:c.*510C>G
      3.

      rs6671164 [Homo sapiens]
        CTGGCTCCGGTGAGCAAAGCACAGA[A/G/T]CTCCATGTGGATAAGGAGGCAGGAA
        Chromosome:
        1:43937817
        Gene:
        LOC105378688 (GeneView)
        Functional Consequence:
        downstream variant 500B
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        G=0.4830/2419
        HGVS:
        CM000663.2:g.43937817G>A, CM000663.2:g.43937817G>T, NC_000001.10:g.44403489G>T, NC_000001.11:g.43937817G>A, NC_000001.11:g.43937817G>T, XR_947283.1:n.1291C>A, XR_947283.1:n.1291C>T
        4.

        rs4660759 [Homo sapiens]
          TGACCCACTGCCACCCCAGTGCCCT[C/G]CCCTGCCCAGGACTTCAGACAGTAG
          Chromosome:
          1:43966828
          Gene:
          IPO13 (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 1000G,by cluster,by frequency,by hapmap
          Global MAF:
          C=0.4551/2279
          HGVS:
          CM000663.2:g.43966828C>G, NC_000001.10:g.44432500C>G, NC_000001.11:g.43966828C>G, NM_014652.3:c.2523+46C>G
          5.

          rs4448553 [Homo sapiens]
            AACTACGGAGCTCTTTGCACTTTTA[A/G]TTTTTTCCTCTTCCCTGCTAGGGTA
            Chromosome:
            1:43945917
            Gene:
            IPO13 (GeneView) LOC101929609 (GeneView)
            Functional Consequence:
            intron variant,upstream variant 2KB
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
            Global MAF:
            A=0.4471/2239
            HGVS:
            CM000663.2:g.43945917A>G, NC_000001.10:g.44411589A>G, NC_000001.11:g.43945917A>G, NM_014652.3:c.-1684A>G, XR_246317.1:n.409+327T>C, XR_246317.3:n.610+327T>C
            6.

            rs2906596 [Homo sapiens]
              GCAGTGGCAGCAGCAGCAGAGACCC[C/T]GGTCAGGACCTACCTTGCTGGAAGA
              Chromosome:
              1:43961276
              Gene:
              IPO13 (GeneView)
              Functional Consequence:
              intron variant
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
              Global MAF:
              G=0.1783/893
              HGVS:
              CM000663.2:g.43961276G>A, NC_000001.10:g.44426948G>A, NC_000001.11:g.43961276G>A, NM_014652.3:c.2344+14G>A
              7.

              rs2486014 [Homo sapiens]
                AGGTCTGCTTTTCTTTCAGGGCCCA[A/G]CCAGAATTTCCCCAAAGGATTTATG
                Chromosome:
                1:43953874
                Gene:
                IPO13 (GeneView)
                Functional Consequence:
                intron variant
                Validated:
                by 1000G,by cluster,by frequency,by submitter
                Global MAF:
                C=0.1102/552
                HGVS:
                CM000663.2:g.43953874T>C, NC_000001.10:g.44419546T>C, NC_000001.11:g.43953874T>C, NM_014652.3:c.822-2446T>C
                8.

                rs2486007 [Homo sapiens]
                  GAGGGGATGTGAGGGGCTGGAGGGT[A/G]GAGGTCTATGTGGTATGCACTGGGG
                  Chromosome:
                  1:43968941
                  Gene:
                  DPH2 (GeneView)
                  Functional Consequence:
                  upstream variant 2KB
                  Validated:
                  by 1000G,by cluster,by frequency
                  Global MAF:
                  G=0.1526/764
                  HGVS:
                  CM000663.2:g.43968941A>G, NC_000001.10:g.44434613A>G, NC_000001.11:g.43968941A>G, NM_001039589.1:c.-1235A>G, NM_001319165.1:c.-1453A>G, NM_001319166.1:c.-1235A>G, NM_001319167.1:c.-1871A>G, NM_001319168.1:c.-1411A>G, NM_001319169.1:c.-1416A>G, NM_001319170.1:c.-1874A>G, NM_001319171.1:c.-1710A>G, NM_001384.4:c.-1235A>G
                  9.

                  rs2428953 [Homo sapiens]
                    CCACAGAGTTACGCTGTGGGACAGA[C/T]GGAGAGAAGTGGCATATGGATAAAG
                    Chromosome:
                    1:43977787
                    Gene:
                    ATP6V0B (GeneView) B4GALT2 (GeneView)
                    Functional Consequence:
                    intron variant,upstream variant 2KB,utr variant 3 prime
                    Validated:
                    by 1000G,by cluster,by frequency
                    Global MAF:
                    A=0.2192/1098
                    HGVS:
                    CM000663.2:g.43977787G>A, NC_000001.10:g.44443459G>A, NC_000001.11:g.43977787G>A, NM_001039457.2:c.451-194G>A, NM_001294333.1:c.*376G>A, NM_003780.4:c.-1777G>A, NM_004047.4:c.592-194G>A
                    10.

                    rs2301993 [Homo sapiens]
                      CACCTCTGAGCAGTCACTATGGGAG[A/C/T]GGAGGGCAAGGGTCAGGGCTCACCT
                      Chromosome:
                      1:43960353
                      Gene:
                      IPO13 (GeneView)
                      Functional Consequence:
                      intron variant
                      Validated:
                      by 1000G,by 2hit 2allele,by cluster,by frequency
                      Global MAF:
                      G=0.4591/2299
                      HGVS:
                      CM000663.2:g.43960353G>A, CM000663.2:g.43960353G>T, NC_000001.10:g.44426025G>A, NC_000001.10:g.44426025G>T, NC_000001.11:g.43960353G>A, NC_000001.11:g.43960353G>T, NM_014652.3:c.2109+24G>A, NM_014652.3:c.2109+24G>T
                      11.

                      rs2301992 [Homo sapiens]
                        ATGTGGACCAGCTACGAGAAAGCAG[A/G]GAATGCTGGTCAGCTGAGACCCAGT
                        Chromosome:
                        1:43961151
                        Gene:
                        IPO13 (GeneView)
                        Functional Consequence:
                        intron variant
                        Validated:
                        by 1000G,by cluster,by frequency
                        Global MAF:
                        T=0.1026/514
                        HGVS:
                        CM000663.2:g.43961151C>T, NC_000001.10:g.44426823C>T, NC_000001.11:g.43961151C>T, NM_014652.3:c.2248-15C>T
                        12.

                        rs2240447 [Homo sapiens]
                          TATCTGCCACAGCACATGGCCAAGC[A/G]TCAGGCATCATGCTGAGAGCCAGTG
                          Chromosome:
                          1:43949743
                          Gene:
                          IPO13 (GeneView)
                          Functional Consequence:
                          synonymous codon
                          Validated:
                          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                          Global MAF:
                          C=0.4948/2478
                          HGVS:
                          CM000663.2:g.43949743C>T, NC_000001.10:g.44415415C>T, NC_000001.11:g.43949743C>T, NM_014652.3:c.411C>T, NP_055467.3:p.Asp137
                          13.

                          rs1990150 [Homo sapiens]
                            TTACTTGAAAGCAGGGAATGATGTT[C/G]ACTTGTTATCCTTAACCCCCGTTTG
                            Chromosome:
                            1:43948455
                            Gene:
                            IPO13 (GeneView) LOC101929609 (GeneView)
                            Functional Consequence:
                            intron variant,upstream variant 2KB
                            Validated:
                            by 1000G,by cluster,by frequency,by submitter
                            Global MAF:
                            G=0.2622/1313
                            HGVS:
                            CM000663.2:g.43948455C>G, NC_000001.10:g.44414127C>G, NC_000001.11:g.43948455C>G, NM_014652.3:c.84+771C>G, XR_246317.1:n.-1803G>C, XR_246317.3:n.-1602G>C
                            14.

                            rs1636879 [Homo sapiens]
                              TCATTTTCTGGCCCACCTCTAGCAG[A/C/G]GTGGCTGCTGAATATCAAACCTGCA
                              Chromosome:
                              1:43963008
                              Gene:
                              IPO13 (GeneView)
                              Functional Consequence:
                              intron variant
                              Validated:
                              by 1000G,by 2hit 2allele,by cluster,by frequency,by submitter
                              Global MAF:
                              C=0.1623/813
                              HGVS:
                              CM000663.2:g.43963008G>A, CM000663.2:g.43963008G>C, NC_000001.10:g.44428680G>C, NC_000001.11:g.43963008G>A, NC_000001.11:g.43963008G>C, NM_014652.3:c.2345-1261G>A, NM_014652.3:c.2345-1261G>C
                              15.

                              rs199150 [Homo sapiens]
                                cagaagctctttagtttaattagat[C/G]ccatttgtcaattctggcttttgtt
                                Chromosome:
                                11:98117828
                                Validated:
                                no info
                                HGVS:
                                CM000673.2:g.98117828C>G, NC_000011.9:g.97988556C>T

                                Display Settings:

                                Format
                                Items per page
                                Sort by

                                Send to:

                                Choose Destination

                                Supplemental Content

                                Find related data

                                Recent activity

                                Your browsing activity is empty.

                                Activity recording is turned off.

                                Turn recording back on

                                See more...
                                Support Center