Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 15

1.

rs10105219 [Homo sapiens]
    ATGTTCTCCATATGAATGCCAGTTT[C/T]AAGAAAATAGTATTTCTTAGAAAAG
    Chromosome:
    8:82944940
    Gene:
    LOC101927141 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency
    Global MAF:
    C=0.4569/2288
    HGVS:
    CM000670.2:g.82944940T>C, NC_000008.10:g.83857175T>C, NC_000008.11:g.82944940T>C, NR_134295.1:n.361-16256T>C
    2.

    rs2169325 [Homo sapiens]
      TCAGCGGCAGCTGAAACCCACTACC[C/T]AAGCTTTGATCTTGGCCTATAGACC
      Chromosome:
      9:24911870
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by submitter
      Global MAF:
      A=0.2716/1360
      HGVS:
      CM000671.2:g.24911870G>A, NC_000009.11:g.24911868G>A
      3.

      rs2102861 [Homo sapiens]
        CTACCATCGCCATGGGCGTGGGTTG[G/T]GGGGAAGATGCATCACAAGACTGTG
        Chromosome:
        8:133507373
        Gene:
        ST3GAL1 (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by 1000G,by cluster,by frequency,by hapmap
        Global MAF:
        A=0.4992/2500
        HGVS:
        CM000670.2:g.133507373A>C, NC_000008.10:g.134519616A>C, NC_000008.11:g.133507373A>C, NM_003033.3:c.-631-8184T>G, NM_173344.2:c.-428-8184T>G
        4.

        rs2028030 [Homo sapiens]
          GCAGTCATTAAGTACATAAGACATT[C/G/T]AGAGTTTCCTGAGCTTGCAGGCCTA
          Chromosome:
          7:107719560
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
          Global MAF:
          T=0.4529/2268
          HGVS:
          CM000669.2:g.107719560C>G, CM000669.2:g.107719560C>T, NC_000007.13:g.107360005C>T, NC_000007.14:g.107719560C>G, NC_000007.14:g.107719560C>T, NG_008489.1:g.63926C>G, NG_008489.1:g.63926C>T
          5.

          rs1562435 [Homo sapiens]
            TGCAGACCATGACTTGGGAAAATTT[C/T]TAATTTAGCGGAAACCTAATTACTC
            Chromosome:
            8:127494212
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency,by submitter
            Global MAF:
            G=0.2688/1346
            HGVS:
            CM000670.2:g.127494212A>G, NC_000008.10:g.128506457A>G
            6.

            rs1013920 [Homo sapiens]
              CTGTGTGTTTTTCCTTCTATTTATT[G/T]TCTCTGTCTGGCTTTCTGTTAACTA
              Chromosome:
              7:110228018
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
              Global MAF:
              G=0.3516/1761
              HGVS:
              CM000669.2:g.110228018G>T, NC_000007.13:g.109868075G>T
              7.

              rs1007750 [Homo sapiens]
                GAAACACAAACATCTAAAGGATTTA[A/C]TTCTCCCATACATTTTCATTTCTGT
                Chromosome:
                8:73074057
                Gene:
                SBSPON (GeneView)
                Functional Consequence:
                intron variant
                Validated:
                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                Global MAF:
                A=0.4886/2447
                HGVS:
                CM000670.2:g.73074057A>C, NC_000008.10:g.73986292A>C, NC_000008.11:g.73074057A>C, NM_153225.3:c.410-2187T>G, XR_928762.2:n.681+462T>G
                8.

                rs997493 [Homo sapiens]
                  AGTAGGTCTCCTGTCATCTCAGCAC[A/G]AGGTACCAGTGCCTTTGGTTCATGC
                  Chromosome:
                  8:60084492
                  Gene:
                  LOC105375861 (GeneView)
                  Functional Consequence:
                  intron variant
                  Validated:
                  by 1000G,by 2hit 2allele,by cluster,by frequency,by submitter
                  Global MAF:
                  A=0.2019/1011
                  HGVS:
                  CM000670.2:g.60084492G>A, NC_000008.10:g.60997051G>A, NC_000008.11:g.60084492G>A, XR_001745714.1:n.657+9769G>A, XR_001745715.1:n.379+9769G>A
                  9.

                  rs887882 [Homo sapiens]
                    AGGGCCACACTGGACACTCTTTCCA[A/G]TTATGCCACAGCCCGCCTGCTGGAA
                    Chromosome:
                    7:106194837
                    Validated:
                    by 1000G,by 2hit 2allele,by cluster,by frequency,by submitter
                    Global MAF:
                    G=0.4243/2125
                    HGVS:
                    CM000669.2:g.106194837A>G, NC_000007.13:g.105835283A>G
                    10.

                    rs755520 [Homo sapiens]
                      CAGCATTTATAGGGACTCTAAGTAA[C/T]GCAATTTAATTTAATGCAAACCAAG
                      Chromosome:
                      8:127966080
                      Gene:
                      PVT1 (GeneView)
                      Functional Consequence:
                      intron variant
                      Validated:
                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                      Global MAF:
                      G=0.4369/2188
                      HGVS:
                      CM000670.2:g.127966080A>G, NC_000008.10:g.128978326A>G, NC_000008.11:g.127966080A>G, NR_003367.3:n.782-17824A>G
                      11.

                      rs748530 [Homo sapiens]
                        CATTTTGCCTTAGCAATTCTCAAGT[C/T]TCACATAGGGAAACTGAGACAGACA
                        Chromosome:
                        9:19639715
                        Gene:
                        SLC24A2 (GeneView)
                        Functional Consequence:
                        intron variant
                        Validated:
                        by 1000G,by 2hit 2allele,by cluster,by frequency
                        Global MAF:
                        T=0.2248/1126
                        HGVS:
                        CM000671.2:g.19639715T>C, NC_000009.11:g.19639713T>C, NC_000009.12:g.19639715T>C, NG_029734.1:g.152305A>G, NM_001193288.2:c.931-17416A>G, NM_020344.3:c.931-17416A>G
                        12.

                        rs716349 [Homo sapiens]
                          TGTGCCATCTTATCTTAAGGTAAAT[A/G]CATGATTTCCCTTAGACTTTCTGAA
                          Chromosome:
                          8:80866542
                          Gene:
                          ZNF704 (GeneView)
                          Functional Consequence:
                          intron variant
                          Validated:
                          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                          Global MAF:
                          C=0.1078/540
                          HGVS:
                          CM000670.2:g.80866542T>C, NC_000008.10:g.81778777T>C, NC_000008.11:g.80866542T>C, NM_001033723.2:c.-22+8029A>G, XR_928797.2:n.842+7002A>G
                          13.

                          rs695167 [Homo sapiens]
                            ACTTCTGCTACCATTgagagagaac[A/G]agagagagagagagagagaATATTT
                            Chromosome:
                            8:69118917
                            Validated:
                            by 1000G,by 2hit 2allele,by cluster,by frequency,by submitter
                            Global MAF:
                            G=0.2330/1167
                            HGVS:
                            CM000670.2:g.69118917G>A, NC_000008.10:g.70031152G>A
                            14.

                            rs9103 [Homo sapiens]
                              TTTCCCATCATGAATCAGAAAGATG[A/C/T]GGACAGCTTGATGTTTTAGACAACC
                              Chromosome:
                              9:27546830
                              Gene:
                              C9orf72 (GeneView)
                              Functional Consequence:
                              utr variant 3 prime
                              Clinical significance:
                              Likely benign
                              Validated:
                              by 1000G,by 2hit 2allele,by cluster,by frequency,by submitter
                              Global MAF:
                              G=0.1675/839
                              HGVS:
                              CM000671.2:g.27546830A>G, NC_000009.11:g.27546828A>G, NC_000009.12:g.27546830A>G, NG_031977.1:g.32037T>C, NM_001256054.1:c.*1406T>C, NM_001256054.2:c.*1406T>C, NM_018325.4:c.*1406T>C
                              15.

                              rs3057 [Homo sapiens]
                                TCTACAGGTTCTGATGGAAGCATCA[A/G]TGATGGATTTGGCTTTTCCATTTGG
                                Chromosome:
                                8:130317591
                                Gene:
                                ASAP1 (GeneView)
                                Functional Consequence:
                                intron variant
                                Validated:
                                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                                Global MAF:
                                C=0.3600/1803
                                HGVS:
                                CM000670.2:g.130317591C>T, NC_000008.10:g.131329837C>T, NC_000008.11:g.130317591C>T, NG_030354.1:g.131070G>A, NM_001247996.1:c.165+40426G>A, NM_018482.3:c.186+40426G>A

                                Display Settings:

                                Format
                                Items per page
                                Sort by

                                Send to:

                                Choose Destination

                                Supplemental Content

                                Find related data

                                Recent activity

                                Your browsing activity is empty.

                                Activity recording is turned off.

                                Turn recording back on

                                See more...
                                Support Center