Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 1 to 20 of 24

1.

rs17473132 [Homo sapiens]
    TTTCTGAGCTGCTTATGATTTCAGC[A/G]TACTGAGAGGAATTTTCAAGAATTG
    Chromosome:
    4:122855376
    Gene:
    FGF2 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by cluster,by frequency
    Global MAF:
    A=0.0833/417
    HGVS:
    CM000666.2:g.122855376G>A, NC_000004.11:g.123776531G>A, NC_000004.12:g.122855376G>A, NG_029067.1:g.33669G>A, NM_002006.4:c.578-20945G>A
    2.

    rs17407577 [Homo sapiens]
      TTAGCCAGTTGAATTGTGAAGAGAA[C/T]GGAATGTGTGGTTTTGGGCTTCTGG
      Chromosome:
      4:122858186
      Gene:
      FGF2 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by cluster,by frequency,by hapmap
      Global MAF:
      C=0.0286/143
      HGVS:
      CM000666.2:g.122858186T>C, NC_000004.11:g.123779341T>C, NC_000004.12:g.122858186T>C, NG_029067.1:g.36479T>C, NM_002006.4:c.578-18135T>C
      3.

      rs12506776 [Homo sapiens]
        CATGGTGACTCTGTAAGATAATTGC[C/T]GGTGGAATTTTTCATCTCCTCAGGA
        Chromosome:
        4:122882215
        Gene:
        FGF2 (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by 1000G,by cluster,by frequency,by hapmap
        Global MAF:
        T=0.2284/1144
        HGVS:
        CM000666.2:g.122882215C>T, NC_000004.11:g.123803370C>T, NC_000004.12:g.122882215C>T, NG_029067.1:g.60508C>T, NM_002006.4:c.681+5791C>T
        4.

        rs11938826 [Homo sapiens]
          CAGAAAAGAGGGTACTTCACACCAG[C/G]TCTGTCACTGGAGATGGTCAGAGAC
          Chromosome:
          4:122851459
          Gene:
          FGF2 (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
          Global MAF:
          G=0.3329/1667
          HGVS:
          CM000666.2:g.122851459C>G, NC_000004.11:g.123772614C>G, NC_000004.12:g.122851459C>G, NG_029067.1:g.29752C>G, NM_002006.4:c.577+24107C>G
          5.

          rs11737764 [Homo sapiens]
            TTTTAGGAGTGCTATGCCCATATTC[A/C/T]CACCCATGAGTCACAGACAGAACTA
            Chromosome:
            4:122905625
            Gene:
            NUDT6 (GeneView)
            Functional Consequence:
            intron variant
            Validated:
            by 1000G,by cluster,by frequency,by hapmap
            Global MAF:
            T=0.2498/1251
            HGVS:
            CM000666.2:g.122905625T>A, CM000666.2:g.122905625T>C, NC_000004.11:g.123826780T>C, NC_000004.12:g.122905625T>A, NC_000004.12:g.122905625T>C, NG_030404.1:g.22380A>G, NG_030404.1:g.22380A>T, NM_007083.4:c.498+6943A>G, NM_007083.4:c.498+6943A>T, NM_198041.2:c.-10+6943A>G, NM_198041.2:c.-10+6943A>T
            6.

            rs10452197 [Homo sapiens]
              TTTAAATTCCTCATTTGTTAATGAG[C/T]ATAATAATGTTAAAATATTGTTGTG
              Chromosome:
              4:122889173
              Gene:
              FGF2 (GeneView)
              Functional Consequence:
              intron variant
              Validated:
              by 1000G,by cluster,by frequency
              Global MAF:
              C=0.0857/429
              HGVS:
              CM000666.2:g.122889173T>C, NC_000004.11:g.123810328T>C, NC_000004.12:g.122889173T>C, NG_029067.1:g.67466T>C, NM_002006.4:c.682-3038T>C
              7.

              rs10003827 [Homo sapiens]
                ATTTTCTTAATCTTTTGCAAATTTA[C/T]AGTCCAAGACATATGCCCTTATGTT
                Chromosome:
                4:122809698
                Validated:
                by 1000G,by 2hit 2allele,by cluster,by frequency
                Global MAF:
                C=0.2756/1380
                HGVS:
                CM000666.2:g.122809698T>C, NC_000004.11:g.123730853T>C
                8.

                rs7700205 [Homo sapiens]
                  acacatcaagtgcccaaatcagcat[C/T]tgacacgtaatagatcctgaaaatt
                  Chromosome:
                  4:122877028
                  Gene:
                  FGF2 (GeneView)
                  Functional Consequence:
                  intron variant
                  Validated:
                  by 1000G,by 2hit 2allele,by cluster,by frequency
                  Global MAF:
                  T=0.0982/492
                  HGVS:
                  CM000666.2:g.122877028C>T, NC_000004.11:g.123798183C>T, NC_000004.12:g.122877028C>T, NG_029067.1:g.55321C>T, NM_002006.4:c.681+604C>T
                  9.

                  rs7694627 [Homo sapiens]
                    ACAGGTAAAACAAACAAAGGAACCA[C/T]GGGTACCAACAGTTCAGAATAAGTG
                    Chromosome:
                    4:122867340
                    Gene:
                    FGF2 (GeneView)
                    Functional Consequence:
                    intron variant
                    Validated:
                    by 1000G,by 2hit 2allele,by cluster,by frequency
                    Global MAF:
                    C=0.0978/490
                    HGVS:
                    CM000666.2:g.122867340T>C, NC_000004.11:g.123788495T>C, NC_000004.12:g.122867340T>C, NG_029067.1:g.45633T>C, NM_002006.4:c.578-8981T>C
                    10.

                    rs6819187 [Homo sapiens]
                      agcagcatgacgacagaatcaaatt[A/C]acacatTTTGCTATTTTTCTAATTA
                      Chromosome:
                      4:122873015
                      Gene:
                      FGF2 (GeneView)
                      Functional Consequence:
                      intron variant
                      Validated:
                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                      Global MAF:
                      A=0.3560/1783
                      HGVS:
                      CM000666.2:g.122873015C>A, NC_000004.11:g.123794170C>A, NC_000004.12:g.122873015C>A, NG_029067.1:g.51308C>A, NM_002006.4:c.578-3306C>A
                      11.

                      rs3804158 [Homo sapiens]
                        TGATTTTTCAATTAAATGCAAATTT[A/G]TGTGGCAGGATTTTTATTGCCATTA
                        Chromosome:
                        4:122893745
                        Gene:
                        FGF2 (GeneView) NUDT6 (GeneView)
                        Functional Consequence:
                        intron variant,utr variant 3 prime
                        Validated:
                        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                        Global MAF:
                        A=0.3175/1590
                        HGVS:
                        CM000666.2:g.122893745G>A, NC_000004.11:g.123814900G>A, NC_000004.12:g.122893745G>A, NG_029067.1:g.72038G>A, NG_030404.1:g.34260C>T, NM_002006.4:c.*1349G>A, NM_007083.4:c.554-520C>T, NM_198041.2:c.47-520C>T
                        12.

                        rs3789138 [Homo sapiens]
                          TTGCTCATGTGGTTATCTTCTATCT[A/G]TACTCCAAAACTTAGCTCAAAACTC
                          Chromosome:
                          4:122863566
                          Gene:
                          FGF2 (GeneView)
                          Functional Consequence:
                          intron variant
                          Validated:
                          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                          Global MAF:
                          G=0.3558/1782
                          HGVS:
                          CM000666.2:g.122863566A>G, NC_000004.11:g.123784721A>G, NC_000004.12:g.122863566A>G, NG_029067.1:g.41859A>G, NM_002006.4:c.578-12755A>G
                          13.

                          rs1960669 [Homo sapiens]
                            TTTCTGTCTTGGATAACTTGGAGGT[G/T]GTTGGAGCAGCAGGAGGGGAAAGTT
                            Chromosome:
                            4:122861413
                            Gene:
                            FGF2 (GeneView)
                            Functional Consequence:
                            intron variant
                            Validated:
                            by 1000G,by 2hit 2allele,by cluster,by frequency
                            Global MAF:
                            A=0.1080/541
                            HGVS:
                            CM000666.2:g.122861413C>A, NC_000004.11:g.123782568C>A, NC_000004.12:g.122861413C>A, NG_029067.1:g.39706C>A, NM_002006.4:c.578-14908C>A
                            14.

                            rs1476217 [Homo sapiens]
                              TACTGATGTATATCCAAAGCTTCTC[A/C/G]TTTTCAGACAGATTAATCCAGAAGC
                              Chromosome:
                              4:122897356
                              Gene:
                              FGF2 (GeneView) NUDT6 (GeneView)
                              Functional Consequence:
                              intron variant,utr variant 3 prime
                              Validated:
                              by 1000G,by 2hit 2allele,by cluster,by frequency,by submitter
                              Global MAF:
                              C=0.4824/2416
                              HGVS:
                              CM000666.2:g.122897356A>C, CM000666.2:g.122897356A>G, NC_000004.11:g.123818511A>C, NC_000004.12:g.122897356A>C, NC_000004.12:g.122897356A>G, NG_029067.1:g.75649A>C, NG_029067.1:g.75649A>G, NG_030404.1:g.30649T>C, NG_030404.1:g.30649T>G, NM_002006.4:c.*4960A>C, NM_002006.4:c.*4960A>G, NM_007083.4:c.553+268T>C, NM_007083.4:c.553+268T>G, NM_198041.2:c.46+268T>C, NM_198041.2:c.46+268T>G
                              15.

                              rs1476214 [Homo sapiens]
                                GTGGATGGATCATAAATACTGCTGG[A/G]AGCTATAGCTTTGGGCTTCCCATAG
                                Chromosome:
                                4:122891854
                                Gene:
                                FGF2 (GeneView)
                                Functional Consequence:
                                intron variant
                                Validated:
                                by 1000G,by 2hit 2allele,by cluster,by frequency,by submitter
                                Global MAF:
                                G=0.4681/2344
                                HGVS:
                                CM000666.2:g.122891854G>A, NC_000004.11:g.123813009G>A, NC_000004.12:g.122891854G>A, NG_029067.1:g.70147G>A, NG_030404.1:g.36151C>T, NM_002006.4:c.682-357G>A
                                16.

                                rs308447 [Homo sapiens]
                                  TCTCATTGACAGTTAAGATCTCTTT[C/T]TGTATTTAGAAGATTAGCTTTGATG
                                  Chromosome:
                                  4:122817391
                                  Validated:
                                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                                  Global MAF:
                                  T=0.4507/2257
                                  HGVS:
                                  CM000666.2:g.122817391C>T, NC_000004.11:g.123738546C>T
                                  17.

                                  rs308443 [Homo sapiens]
                                    TCTTACTGAAGACTTTCAGGCAAAG[A/G]AGCCGTTTCCAACTTCCTACTAAGT
                                    Chromosome:
                                    4:122854612
                                    Gene:
                                    FGF2 (GeneView)
                                    Functional Consequence:
                                    intron variant
                                    Validated:
                                    by 1000G,by cluster,by frequency,by submitter
                                    Global MAF:
                                    A=0.1124/563
                                    HGVS:
                                    CM000666.2:g.122854612G>A, NC_000004.11:g.123775767G>A, NC_000004.12:g.122854612G>A, NG_029067.1:g.32905G>A, NM_002006.4:c.578-21709G>A
                                    18.

                                    rs308441 [Homo sapiens]
                                      TGATGCATTTCTTTTCAAGAACCTA[C/T]GGTATGTTTATAGTCCAGATTGCAT
                                      Chromosome:
                                      4:122852910
                                      Gene:
                                      FGF2 (GeneView)
                                      Functional Consequence:
                                      intron variant
                                      Validated:
                                      by 1000G,by 2hit 2allele,by cluster,by frequency
                                      Global MAF:
                                      T=0.3405/1705
                                      HGVS:
                                      CM000666.2:g.122852910C>T, NC_000004.11:g.123774065C>T, NC_000004.12:g.122852910C>T, NG_029067.1:g.31203C>T, NM_002006.4:c.578-23411C>T
                                      19.

                                      rs308439 [Homo sapiens]
                                        GCAAGCTCCATTGTGTAAGCCGCTG[G/T]TTGCATCCTGTTTGCTAATATCAAA
                                        Chromosome:
                                        4:122852424
                                        Gene:
                                        FGF2 (GeneView)
                                        Functional Consequence:
                                        intron variant
                                        Validated:
                                        by 1000G,by 2hit 2allele,by cluster,by frequency
                                        Global MAF:
                                        G=0.1074/538
                                        HGVS:
                                        CM000666.2:g.122852424T>G, NC_000004.11:g.123773579T>G, NC_000004.12:g.122852424T>G, NG_029067.1:g.30717T>G, NM_002006.4:c.578-23897T>G
                                        20.

                                        rs308435 [Homo sapiens]
                                          GGCTTCTTTTTTGGGATGGAAGTGT[A/C/T]AGTACTGGAGCCAGAAACTATTTCC
                                          Chromosome:
                                          4:122850863
                                          Gene:
                                          FGF2 (GeneView)
                                          Functional Consequence:
                                          intron variant
                                          Validated:
                                          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                                          Global MAF:
                                          A=0.2917/1461
                                          HGVS:
                                          CM000666.2:g.122850863C>A, CM000666.2:g.122850863C>T, NC_000004.11:g.123772018C>A, NC_000004.12:g.122850863C>A, NC_000004.12:g.122850863C>T, NG_029067.1:g.29156C>A, NG_029067.1:g.29156C>T, NM_002006.4:c.577+23511C>A, NM_002006.4:c.577+23511C>T

                                          Display Settings:

                                          Format
                                          Items per page
                                          Sort by

                                          Send to:

                                          Choose Destination

                                          Supplemental Content

                                          Find related data

                                          Recent activity

                                          Your browsing activity is empty.

                                          Activity recording is turned off.

                                          Turn recording back on

                                          See more...
                                          Support Center