Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 4

1.

rs11259365 [Homo sapiens]
    TCTGCCAATGTATCATCTAGGTGAT[C/G]AAAGTTAGGAATACTAACTTGTCCT
    Chromosome:
    10:14834528
    Gene:
    CDNF (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    C=0.1563/783
    HGVS:
    NC_000010.10:g.14876527G>C, NC_000010.11:g.14834528G>C, NM_001029954.2:c.115+3304C>G, XM_011519488.2:c.115+3304C>G
    2.

    rs7900873 [Homo sapiens]
      TTCCTTTGGGATGGCCTTGGTTTGC[A/G]GCCAACTTGAAACCCATAGATTGTA
      Chromosome:
      10:14821865
      Gene:
      CDNF (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      A=0.4527/2267
      HGVS:
      NC_000010.10:g.14863864G>A, NC_000010.11:g.14821865G>A, NM_001029954.2:c.386-1707C>T, XM_011519488.2:c.413-1707C>T
      3.

      rs7094179 [Homo sapiens]
        CTTCTGTTTTTTGTTCCAGCTGGCT[A/C]TCACTTATGTGCCCTTCTTCCCTAG
        Chromosome:
        10:14830428
        Gene:
        CDNF (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        A=0.4309/2158
        HGVS:
        NC_000010.10:g.14872427C>A, NC_000010.11:g.14830428C>A, NM_001029954.2:c.116-2156G>T, XM_011519488.2:c.116-2156G>T
        4.

        rs2278871 [Homo sapiens]
          TTGCCAAACATTGGCTATACTTATA[C/T]GGTTTCTTGATCTCTCTATTTTCTT
          Chromosome:
          10:14819402
          Gene:
          CDNF (GeneView)
          Functional Consequence:
          utr variant 3 prime
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
          Global MAF:
          T=0.2578/1291
          HGVS:
          NC_000010.10:g.14861401C>T, NC_000010.11:g.14819402C>T, NM_001029954.2:c.*578G>A, XM_011519488.2:c.*578G>A

          Display Settings:

          Format
          Sort by

          Send to:

          Choose Destination

          Supplemental Content

          Find related data

          Recent activity

          Your browsing activity is empty.

          Activity recording is turned off.

          Turn recording back on

          See more...
          Support Center