Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 17

2.

rs17426596 [Homo sapiens]
    CCAAGAGAACTTTTCACAATGGTTT[C/T]TCAGGTGTCAAAATAGCTTGGATTA
    Chromosome:
    15:48131886
    Gene:
    SLC24A5 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    C=0.0136/68
    HGVS:
    NC_000015.10:g.48131886T>C, NC_000015.9:g.48424083T>C, NG_011500.1:g.15915T>C, NM_205850.2:c.302-2372T>C, XM_005254308.1:c.302-2372T>C, XM_005254309.1:c.122-2372T>C, XM_017022079.1:c.-38-2372T>C, XM_017022080.1:c.-38-2372T>C
    4.

    rs6058017 [Homo sapiens]
      AGCGCCCCCACTCCCGGCCGCGAGC[A/G]GGCAGGGCTTCGGGGACGCGGGGCG
      Chromosome:
      20:34269192
      Gene:
      AHCY (GeneView) ASIP (GeneView)
      Functional Consequence:
      intron variant,utr variant 3 prime
      Allele Origin:
      G(germline)/A(germline)
      Clinical significance:
      other
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      G=0.3237/1621
      HGVS:
      NC_000020.10:g.32856998A>G, NC_000020.11:g.34269192A>G, NG_011439.1:g.13828A>G, NM_001672.2:c.*25A>G, XM_005260412.1:c.*25A>G, XM_005260412.3:c.*25A>G, XM_011528657.2:c.*7+11835T>C, XM_011528820.2:c.*25A>G, XM_011528821.1:c.*25A>G
      5.

      rs4911414 [Homo sapiens]
        gtaagtctttgctgagaaattcatt[G/T]ttagtctaatatgatgcttttctct
        Chromosome:
        20:34141638
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        T=0.2023/1013
        HGVS:
        NC_000020.10:g.32729444T>G, NC_000020.11:g.34141638T>G
        6.

        rs3886999 [Homo sapiens]
          AAACCACTTACAATAACATGTTCCT[C/T]TGAGAGGGTTTCCTTGGTATCGATT
          Chromosome:
          20:3596415
          Gene:
          ATRN (GeneView)
          Functional Consequence:
          missense
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
          Global MAF:
          A=0.0178/89
          HGVS:
          NC_000020.10:g.3577062G>A, NC_000020.11:g.3596415G>A, NG_029406.1:g.130398G>A, NM_001207047.2:c.3107G>A, NM_001323332.1:c.3455G>A, NM_139321.2:c.3455G>A, NM_139322.3:c.3455G>A, NP_001193976.1:p.Arg1036Lys, NP_001310261.1:p.Arg1152Lys, NP_647537.1:p.Arg1152Lys, NP_647538.1:p.Arg1152Lys, XM_005260860.1:c.3455G>A, XP_005260917.1:p.Arg1152Lys
          9.

          rs1426654 [Homo sapiens]
            TGGATTGTCTCAGGATGTTGCAGGC[A/G/T]CAACTTTCATGGCAGCGGGCAGTTC
            Chromosome:
            15:48134287
            Gene:
            MYEF2 (GeneView) SLC24A5 (GeneView)
            Functional Consequence:
            downstream variant 500B,missense,utr variant 5 prime
            Allele Origin:
            G(germline)/A(germline)
            Clinical significance:
            other
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
            Global MAF:
            A=0.4377/2192
            HGVS:
            NC_000015.10:g.48134287A, NC_000015.10:g.48134287A>G, NC_000015.10:g.48134287A>T, NC_000015.9:g.48426484A, NC_000015.9:g.48426484A>G, NC_000015.9:g.48426484A>T, NG_011500.1:g.18316A, NG_011500.1:g.18316A>G, NG_011500.1:g.18316A>T, NM_205850.2:c.331A, NM_205850.2:c.331A>G, NM_205850.2:c.331A>T, NP_995322.1:p.Thr111, NP_995322.1:p.Thr111Ala, NP_995322.1:p.Thr111Ser, XM_005254308.1:c.331A, XM_005254308.1:c.331A>G, XM_005254308.1:c.331A>T, XM_005254309.1:c.151A, XM_005254309.1:c.151A>G, XM_005254309.1:c.151A>T, XM_005254425.4:c.*8776T, XM_005254425.4:c.*8776T>A, XM_005254425.4:c.*8776T>C, XM_017022079.1:c.-9A, XM_017022079.1:c.-9A>G, XM_017022079.1:c.-9A>T, XM_017022080.1:c.-9A, XM_017022080.1:c.-9A>G, XM_017022080.1:c.-9A>T, XM_017022285.1:c.*8776T, XM_017022285.1:c.*8776T>A, XM_017022285.1:c.*8776T>C, XM_017022286.1:c.*8776T, XM_017022286.1:c.*8776T>A, XM_017022286.1:c.*8776T>C, XM_017022287.1:c.*8776T, XM_017022287.1:c.*8776T>A, XM_017022287.1:c.*8776T>C, XM_017022291.1:c.*8776T, XM_017022291.1:c.*8776T>A, XM_017022291.1:c.*8776T>C, XM_017022292.1:c.*8776T, XM_017022292.1:c.*8776T>A, XM_017022292.1:c.*8776T>C, XP_005254365.1:p.Thr111, XP_005254365.1:p.Thr111Ala, XP_005254365.1:p.Thr111Ser, XP_005254366.1:p.Thr51, XP_005254366.1:p.Thr51Ala, XP_005254366.1:p.Thr51Ser
            10.

            rs1408799 [Homo sapiens]
              GGTTCATCCACTTAATGAATGAATA[C/T]TGACCATGTGCTCCGAGCCAGACAA
              Chromosome:
              9:12672097
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
              Global MAF:
              C=0.2772/1388
              HGVS:
              NC_000009.11:g.12672097T>C, NC_000009.12:g.12672097T>C
              11.

              rs1393350 [Homo sapiens]
                TCTTCCTCAGTCCCTTCTCTGCAAC[A/G]AAATCTGTGTGGTCTTTTACAAATG
                Chromosome:
                11:89277878
                Gene:
                LOC107984363 (GeneView) TYR (GeneView)
                Functional Consequence:
                intron variant
                Validated:
                by 1000G,by cluster,by frequency,by hapmap,by submitter
                Global MAF:
                A=0.0793/397
                HGVS:
                NC_000011.10:g.89277878G>A, NC_000011.9:g.89011046G>A, NG_008748.1:g.105007G>A, NM_000372.4:c.1185-6895G>A, XM_011542970.2:c.1185-6895G>A, XR_001748321.1:n.2457-943C>T, XR_001748322.1:n.2458-1069C>T
                12.

                rs1126809 [Homo sapiens]
                  TGCAGTATTTTTGAGCAGTGGCTCC[A/G]AAGGCACCGTCCTCTTCAAGAAGTT
                  Chromosome:
                  11:89284793
                  Gene:
                  LOC107984363 (GeneView) TYR (GeneView)
                  Functional Consequence:
                  intron variant,missense
                  Allele Origin:
                  G(germline)/A(germline)
                  Clinical significance:
                  Pathogenic
                  Validated:
                  by 1000G,by cluster,by frequency,by hapmap
                  Global MAF:
                  A=0.0813/407
                  HGVS:
                  NC_000011.10:g.89284793G>A, NC_000011.9:g.89017961G>A, NG_008748.1:g.111922G>A, NM_000372.4:c.1205G>A, NP_000363.1:p.Arg402Gln, XM_011542970.2:c.1205G>A, XP_011541272.1:p.Arg402Gln, XR_001748321.1:n.2456+1241C>T, XR_001748322.1:n.2457+1241C>T
                  13.

                  rs1042602 [Homo sapiens]
                    TCAATGGATGCACTGCTTGGGGGAT[A/C]TGAAATCTGGAGAGACATTGATTTT
                    Chromosome:
                    11:89178528
                    Gene:
                    LOC107984363 (GeneView) TYR (GeneView)
                    Functional Consequence:
                    intron variant,missense
                    Allele Origin:
                    A(germline)/C(germline)
                    Clinical significance:
                    other
                    Validated:
                    by 1000G,by cluster,by frequency,by hapmap
                    Global MAF:
                    A=0.1234/618
                    HGVS:
                    NC_000011.10:g.89178528C>A, NC_000011.9:g.88911696C>A, NG_008748.1:g.5657C>A, NM_000372.4:c.575C>A, NP_000363.1:p.Ser192Tyr, XM_011542970.2:c.575C>A, XP_011541272.1:p.Ser192Tyr, XR_001748321.1:n.2718-64995G>T, XR_001748322.1:n.2733-64995G>T
                    14.

                    rs1042571 [Homo sapiens]
                      GGTCGACCCCAAAGCCNCTTGCTCT[C/T]CCCTGCCCTGCTGCCGCCTCCCAGC
                      Chromosome:
                      2:25161018
                      Gene:
                      POMC (GeneView)
                      Functional Consequence:
                      utr variant 3 prime
                      Clinical significance:
                      Likely benign
                      Validated:
                      by 1000G,by cluster,by frequency
                      Global MAF:
                      A=0.1156/579
                      HGVS:
                      NC_000002.11:g.25383887G>A, NC_000002.12:g.25161018G>A, NG_008997.1:g.12673C>T, NM_000939.3:c.*63C>T, NM_001035256.2:c.*63C>T, NM_001319204.1:c.*63C>T, NM_001319205.1:c.*63C>T, XM_005264371.1:c.*63C>T
                      15.

                      rs1015362 [Homo sapiens]
                        GTGTGTACTGTGTGTCTGAAACAGT[A/G]TGAGATGTTTTCATCTCCTGGTCGG
                        Chromosome:
                        20:34150806
                        Validated:
                        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                        Global MAF:
                        T=0.3970/1988
                        HGVS:
                        NC_000020.10:g.32738612C>T, NC_000020.11:g.34150806C>T
                        16.

                        rs26722 [Homo sapiens]
                          TTTACGTAACCATTTTTAACTTTCT[C/T]GATAGAACCATACTCGTACATTCCA
                          Chromosome:
                          5:33963765
                          Gene:
                          SLC45A2 (GeneView)
                          Functional Consequence:
                          intron variant,missense
                          Allele Origin:
                          T(germline)/C(germline)
                          Clinical significance:
                          other
                          Validated:
                          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                          Global MAF:
                          T=0.1781/892
                          HGVS:
                          NC_000005.10:g.33963765C>T, NC_000005.9:g.33963870C>T, NG_011691.2:g.25911G>A, NM_001012509.3:c.814G>A, NM_001297417.2:c.563-9261G>A, NM_016180.4:c.814G>A, NP_001012527.1:p.Glu272Lys, NP_057264.3:p.Glu272Lys, XM_005248311.1:c.563-9261G>A
                          17.

                          rs13289 [Homo sapiens]
                            GTACCACGAGGAGAAATATCAGGGC[C/G]ATCTGACACAGCTAATGATTTGAAG
                            Chromosome:
                            5:33986304
                            Gene:
                            SLC45A2 (GeneView)
                            Functional Consequence:
                            upstream variant 2KB
                            Validated:
                            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                            Global MAF:
                            G=0.4441/2224
                            HGVS:
                            NC_000005.10:g.33986304C>G, NC_000005.9:g.33986409C>G, NG_011691.2:g.3372G>C, NG_016211.1:g.26812G>C, NM_001012509.3:c.-1721G>C, NM_001297417.2:c.-1721G>C, NM_016180.4:c.-1721G>C, XM_005248311.1:c.-1721G>C

                            Display Settings:

                            Format
                            Items per page
                            Sort by

                            Send to:

                            Choose Destination

                            Supplemental Content

                            Find related data

                            Recent activity

                            Your browsing activity is empty.

                            Activity recording is turned off.

                            Turn recording back on

                            See more...
                            Support Center