Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 3

1.

rs2254298 [Homo sapiens]
    TCAGAGGAAGAAGCCCCGCAAACTG[A/G]GAAAACAGGGATGGTTTCCTGAAAG
    Chromosome:
    3:8760542
    Gene:
    OXTR (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    A=0.2071/1037
    HGVS:
    NC_000003.11:g.8802228G>A, NC_000003.12:g.8760542G>A, NG_008797.2:g.31733G>A, NM_000916.3:c.922+6724C>T, XM_011533762.2:c.922+6724C>T
    2.

    rs2228485 [Homo sapiens]
      TCCTGCTCCTGGCGCTGAGCGGGAA[C/T]GCGTGTGTGCTGCTGGCGCTGCGCA
      Chromosome:
      3:8768017
      Gene:
      OXTR (GeneView)
      Functional Consequence:
      synonymous codon
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency
      Global MAF:
      G=0.2821/1413
      HGVS:
      NC_000003.11:g.8809703G>A, NC_000003.12:g.8768017G>A, NG_008797.2:g.39208G>A, NM_000916.3:c.171C>T, NP_000907.2:p.Asn57, XM_011533762.2:c.171C>T, XP_011532064.1:p.Asn57
      3.

      rs53576 [Homo sapiens]
        AAAGGTGTACGGGACATGCCCGAGG[A/G]TCCTCAGTCCCACAGAAACAGGGAG
        Chromosome:
        3:8762685
        Gene:
        OXTR (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
        Global MAF:
        A=0.3894/1950
        HGVS:
        NC_000003.11:g.8804371A>G, NC_000003.12:g.8762685A>G, NG_008797.2:g.33876A>G, NM_000916.3:c.922+4581T>C, XM_011533762.2:c.922+4581T>C

        Display Settings:

        Format
        Sort by

        Send to:

        Choose Destination

        Supplemental Content

        Find related data

        Recent activity

        Your browsing activity is empty.

        Activity recording is turned off.

        Turn recording back on

        See more...
        Support Center