Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 3

1.

rs3824968 [Homo sapiens]
    TGAGGCCCAAAAAAATGCCCTCTGC[A/T]TCTTGTGTATATAATGTCTACTACA
    Chromosome:
    11:121605213
    Gene:
    SORL1 (GeneView)
    Functional Consequence:
    synonymous codon
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency
    Global MAF:
    A=0.3962/1984
    HGVS:
    CM000673.2:g.121605213T>A, NC_000011.10:g.121605213T>A, NC_000011.9:g.121475922T>A, NG_023313.1:g.157962T>A, NM_003105.5:c.4752T>A, NP_003096.1:p.Ala1584, XP_005271709.1:p.Ala494, XP_011541265.1:p.Ala1546, XP_011541267.1:p.Ala1071, XP_011541269.1:p.Ala528, XP_016873658.1:p.Ala1480, XP_016873659.1:p.Ala1409, XP_016873660.1:p.Ala1584, XP_016873661.1:p.Ala704
    2.

    rs2070045 [Homo sapiens]
      GGGACAACGACTGCAGGGACTGGTC[G/T]GATGAAGCCAACTGTACCGGTCAGT
      Chromosome:
      11:121577381
      Gene:
      SORL1 (GeneView)
      Functional Consequence:
      synonymous codon
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      G=0.3409/1707
      HGVS:
      CM000673.2:g.121577381T>G, NC_000011.10:g.121577381T>G, NC_000011.9:g.121448090T>G, NG_023313.1:g.130130T>G, NM_003105.5:c.3561T>G, NP_003096.1:p.Ser1187, XP_005271709.1:p.Ser97, XP_011541265.1:p.Ser1149, XP_011541267.1:p.Ser674, XP_011541269.1:p.Ser131, XP_016873658.1:p.Ser1083, XP_016873659.1:p.Ser1012, XP_016873660.1:p.Ser1187, XP_016873661.1:p.Ser307
      3.

      rs1010159 [Homo sapiens]
        CATGTTAGATGAACAGCTAGTCATG[A/G]GGCACACTAAATACAAAAGGCAGGA
        Chromosome:
        11:121612692
        Gene:
        SORL1 (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by submitter
        Global MAF:
        T=0.4547/2277
        HGVS:
        CM000673.2:g.121612692C>T, NC_000011.10:g.121612692C>T, NC_000011.9:g.121483401C>T, NG_023313.1:g.165441C>T, NM_003105.5:c.5323-44C>T

        Display Settings:

        Format
        Sort by

        Send to:

        Choose Destination

        Supplemental Content

        Find related data

        Recent activity

        Your browsing activity is empty.

        Activity recording is turned off.

        Turn recording back on

        See more...
        Support Center