Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 3

1.

rs9479510 [Homo sapiens]
    GCATTTCAGGCTGAAAACAGCTGAG[C/G]AAAGGCACACAGAAGTGGCAAAAGA
    Chromosome:
    6:153106382
    Gene:
    RGS17 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    G=0.4369/2188
    HGVS:
    NC_000006.11:g.153427517G>C, NC_000006.12:g.153106382G>C, NM_012419.4:c.-26+24742C>G, XM_017010733.1:c.-26+24742C>G
    2.

    rs6901126 [Homo sapiens]
      TCTCCACATCCTCGGTTTTATGGCA[C/T]ATTACAGTGTCTTCATTCTCTTTAT
      Chromosome:
      6:153118927
      Gene:
      RGS17 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      T=0.4453/2230
      HGVS:
      NC_000006.11:g.153440062T>C, NC_000006.12:g.153118927T>C, NM_012419.4:c.-26+12197A>G, XM_017010733.1:c.-26+12197A>G
      3.

      rs4083914 [Homo sapiens]
        AGTTCACTGTTTTGTAAGGCAACTG[C/G]TTTCACTGTTGATCAACAATCCTGG
        Chromosome:
        6:153106571
        Gene:
        RGS17 (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by 1000G,by cluster,by frequency,by hapmap
        Global MAF:
        C=0.4341/2174
        HGVS:
        NC_000006.11:g.153427706C>G, NC_000006.12:g.153106571C>G, NM_012419.4:c.-26+24553G>C, XM_017010733.1:c.-26+24553G>C

        Display Settings:

        Format
        Sort by

        Send to:

        Choose Destination

        Supplemental Content

        Find related data

        Recent activity

        Your browsing activity is empty.

        Activity recording is turned off.

        Turn recording back on

        See more...
        Support Center