Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 15

2.
5.

rs4265993 [Homo sapiens]
    tttattgagagtttttaacctgaag[C/G/T]ggtgttgaattttattgaaagcctt
    Chromosome:
    2:217347722
    Gene:
    DIRC3 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    C=0.0515/258
    HGVS:
    NC_000002.11:g.218212445C>G, NC_000002.11:g.218212445C>T, NC_000002.12:g.217347722C>G, NC_000002.12:g.217347722C>T, NR_026597.1:n.2291-19570G>A, NR_026597.1:n.2291-19570G>C, XR_241321.1:n.1459-19570G>A, XR_241321.1:n.1459-19570G>C
    9.
    10.
    11.

    rs3754934 [Homo sapiens]
      AGCTCCGTAAAGAACTTAGTCATTC[A/G/T]AGTCTTTAAGTGTGGCAGAAAACCC
      Chromosome:
      2:201267384
      Gene:
      CASP8 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      A=0.1825/914
      HGVS:
      NC_000002.11:g.202132107C>A, NC_000002.12:g.201267384C>A, NC_000002.12:g.201267384C>T, NG_007497.1:g.38927C>A, NG_007497.1:g.38927C>T, NM_001080124.1:c.305+593C>A, NM_001080124.1:c.305+593C>T, NM_001080125.1:c.482+593C>A, NM_001080125.1:c.482+593C>T, NM_001228.4:c.305+593C>A, NM_001228.4:c.305+593C>T, NM_033355.3:c.305+593C>A, NM_033355.3:c.305+593C>T, NM_033356.3:c.305+593C>A, NM_033356.3:c.305+593C>T, NM_033358.3:c.305+593C>A, NM_033358.3:c.305+593C>T, NR_111983.1:n.683+593C>A, NR_111983.1:n.683+593C>T, XM_005246885.1:c.482+593C>A, XM_005246885.1:c.482+593C>T, XM_005246886.1:c.305+593C>A, XM_005246886.1:c.305+593C>T, XM_005246887.1:c.305+593C>A, XM_005246887.1:c.305+593C>T, XM_005246888.1:c.305+593C>A, XM_005246888.1:c.305+593C>T, XM_005246889.1:c.305+593C>A, XM_005246889.1:c.305+593C>T, XM_005246890.1:c.305+593C>A, XM_005246890.3:c.305+593C>A, XM_005246890.3:c.305+593C>T, XM_005246891.1:c.305+593C>A, XM_005246891.4:c.305+593C>A, XM_005246891.4:c.305+593C>T, XM_005246892.1:c.305+593C>A, XM_005246892.1:c.305+593C>T, XM_005246893.1:c.482+593C>A, XM_005246893.2:c.482+593C>A, XM_005246893.2:c.482+593C>T, XM_005246894.1:c.-228+593C>A, XM_005246894.3:c.-228+593C>A, XM_005246894.3:c.-228+593C>T, XM_005246895.1:c.482+593C>A, XM_005246895.2:c.482+593C>A, XM_005246895.2:c.482+593C>T, XM_005246896.1:c.305+593C>A, XM_006712789.1:c.305+593C>A, XM_006712789.1:c.305+593C>T, XM_006712790.3:c.305+593C>A, XM_006712790.3:c.305+593C>T, XM_006712793.2:c.305+593C>A, XM_006712793.2:c.305+593C>T, XM_011511969.1:c.-25+593C>A, XM_011511969.1:c.-25+593C>T, XR_001738971.1:n.581+593C>A, XR_001738971.1:n.581+593C>T, XR_241323.1:n.503+593C>A, XR_923035.1:n.503+593C>A, XR_923035.1:n.503+593C>T
      13.

      rs1045487 [Homo sapiens]
        GCTGTATCCTCTCCCATGGAGACAA[A/G]GGCATCATCTATGGCACTGATGGAC
        Chromosome:
        2:201284973
        Gene:
        CASP8 (GeneView)
        Functional Consequence:
        downstream variant 500B,nc transcript variant,synonymous codon
        Clinical significance:
        Benign
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
        Global MAF:
        A=0.1753/878
        HGVS:
        NC_000002.11:g.202149696G>A, NC_000002.12:g.201284973G>A, NG_007497.1:g.56516G>A, NM_001080124.1:c.915G>A, NM_001080125.1:c.1137G>A, NM_001228.4:c.1011G>A, NM_033355.3:c.960G>A, NM_033356.3:c.915G>A, NP_001073593.1:p.Lys305, NP_001073594.1:p.Lys379, NP_001219.2:p.Lys337, NP_203519.1:p.Lys320, NP_203520.1:p.Lys305, NR_111983.1:n.1474G>A, XM_005246885.1:c.1092G>A, XM_005246886.1:c.960G>A, XM_005246887.1:c.960G>A, XM_005246888.1:c.960G>A, XM_005246889.1:c.960G>A, XM_005246890.1:c.960G>A, XM_005246890.3:c.960G>A, XM_005246891.1:c.960G>A, XM_005246891.4:c.960G>A, XM_005246892.1:c.915G>A, XM_005246893.1:c.*187G>A, XM_005246893.2:c.*187G>A, XM_005246894.1:c.363G>A, XM_005246894.3:c.363G>A, XM_005246895.1:c.*187G>A, XM_005246895.2:c.*187G>A, XM_006712789.1:c.960G>A, XM_006712790.3:c.960G>A, XM_006712793.2:c.*187G>A, XM_011511969.1:c.525G>A, XP_005246942.1:p.Lys364, XP_005246943.1:p.Lys320, XP_005246944.1:p.Lys320, XP_005246945.1:p.Lys320, XP_005246946.1:p.Lys320, XP_005246947.1:p.Lys320, XP_005246948.1:p.Lys320, XP_005246949.1:p.Lys305, XP_005246951.1:p.Lys121, XP_006712852.1:p.Lys320, XP_006712853.1:p.Lys320, XP_011510271.1:p.Lys175, XR_001738971.1:n.1307G>A, XR_241323.1:n.1294G>A, XR_923035.1:n.1229G>A
        14.

        rs1045485 [Homo sapiens]
          GCTTCATTTTGAGATCAAGCCCCAC[C/G]ATGACTGCACAGTAGAGCAAATCTA
          Chromosome:
          2:201284866
          Gene:
          CASP8 (GeneView)
          Functional Consequence:
          missense,nc transcript variant,utr variant 3 prime
          Allele Origin:
          G(germline)/C(germline)
          Clinical significance:
          other
          Validated:
          by 1000G,by cluster,by frequency,by hapmap
          Global MAF:
          C=0.0527/264
          HGVS:
          NC_000002.11:g.202149589G>C, NC_000002.12:g.201284866G>C, NG_007497.1:g.56409G>C, NM_001080124.1:c.808G>C, NM_001080125.1:c.1030G>C, NM_001228.4:c.904G>C, NM_033355.3:c.853G>C, NM_033356.3:c.808G>C, NP_001073593.1:p.Asp270His, NP_001073594.1:p.Asp344His, NP_001219.2:p.Asp302His, NP_203519.1:p.Asp285His, NP_203520.1:p.Asp270His, NR_111983.1:n.1367G>C, XM_005246885.1:c.985G>C, XM_005246886.1:c.853G>C, XM_005246887.1:c.853G>C, XM_005246888.1:c.853G>C, XM_005246889.1:c.853G>C, XM_005246890.1:c.853G>C, XM_005246890.3:c.853G>C, XM_005246891.1:c.853G>C, XM_005246891.4:c.853G>C, XM_005246892.1:c.808G>C, XM_005246893.1:c.*80G>C, XM_005246893.2:c.*80G>C, XM_005246894.1:c.256G>C, XM_005246894.3:c.256G>C, XM_005246895.1:c.*80G>C, XM_005246895.2:c.*80G>C, XM_006712789.1:c.853G>C, XM_006712790.3:c.853G>C, XM_006712793.2:c.*80G>C, XM_011511969.1:c.418G>C, XP_005246942.1:p.Asp329His, XP_005246943.1:p.Asp285His, XP_005246944.1:p.Asp285His, XP_005246945.1:p.Asp285His, XP_005246946.1:p.Asp285His, XP_005246947.1:p.Asp285His, XP_005246948.1:p.Asp285His, XP_005246949.1:p.Asp270His, XP_005246951.1:p.Asp86His, XP_006712852.1:p.Asp285His, XP_006712853.1:p.Asp285His, XP_011510271.1:p.Asp140His, XR_001738971.1:n.1200G>C, XR_241323.1:n.1187G>C, XR_923035.1:n.1122G>C

          Display Settings:

          Format
          Items per page
          Sort by

          Send to:

          Choose Destination

          Supplemental Content

          Find related data

          Recent activity

          Your browsing activity is empty.

          Activity recording is turned off.

          Turn recording back on

          See more...
          Support Center