Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 7

1.

rs17340148 [Homo sapiens]
    TTGAAGGCAGGCTTCAAAGGCCCAC[C/T]GAAGCTGAGATTCTAACAATGCATT
    Chromosome:
    X:139566088
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    T=0.0188/71
    HGVS:
    NC_000023.10:g.138648247C>T, NC_000023.11:g.139566088C>T
    2.

    rs4149755 [Homo sapiens]
      TCCAGATGCAATATTACTGGTACTG[A/T]GATTGAGAAACGCACACAGTGCTAA
      Chromosome:
      X:139541953
      Gene:
      F9 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by cluster,by frequency
      Global MAF:
      A=0.0201/76
      HGVS:
      NC_000023.10:g.138624112T>A, NC_000023.11:g.139541953T>A, NG_007994.1:g.16218T>A, NM_000133.3:c.391+764T>A, NM_001313913.1:c.277+4567T>A, XM_005262396.1:c.277+4567T>A, XM_005262397.1:c.391+764T>A, XM_005262397.4:c.391+764T>A
      3.

      rs4149754 [Homo sapiens]
        ACAATACTCAGTTGAGTTCCCTAGG[A/G]GAGAAAAGCAAGCTTAAGAATTGAC
        Chromosome:
        X:139531533
        Gene:
        F9 (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by 1000G,by cluster,by frequency,by hapmap
        Global MAF:
        A=0.0305/115
        HGVS:
        NC_000023.10:g.138613692G>A, NC_000023.11:g.139531533G>A, NG_007994.1:g.5798G>A, NM_000133.3:c.88+681G>A, NM_001313913.1:c.88+681G>A, XM_005262396.1:c.88+681G>A, XM_005262397.1:c.88+681G>A, XM_005262397.4:c.88+681G>A
        5.

        rs438601 [Homo sapiens]
          AAGTCCTCCTCATTATCATGGCCCA[C/G]AAGCCCTTCCATGATTGTCCTTCCC
          Chromosome:
          X:139537760
          Gene:
          F9 (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 1000G,by cluster,by frequency,by hapmap
          Global MAF:
          G=0.0988/373
          HGVS:
          NC_000023.10:g.138619919C>G, NC_000023.11:g.139537760C>G, NG_007994.1:g.12025C>G, NM_000133.3:c.277+374C>G, NM_001313913.1:c.277+374C>G, XM_005262396.1:c.277+374C>G, XM_005262397.1:c.277+374C>G, XM_005262397.4:c.277+374C>G
          6.

          rs422187 [Homo sapiens]
            GTTAAAGTTACAAAGCATCAATCAT[A/C]AGACTTCCATTCAGGGATGGCAATT
            Chromosome:
            X:139550700
            Gene:
            F9 (GeneView)
            Functional Consequence:
            intron variant
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
            Global MAF:
            C=0.2668/1007
            HGVS:
            NC_000023.10:g.138632859A>C, NC_000023.11:g.139550700A>C, NG_007994.1:g.24965A>C, NM_000133.3:c.521-362A>C, NM_001313913.1:c.407-362A>C, XM_005262396.1:c.407-362A>C, XM_005262397.1:c.392-362A>C, XM_005262397.4:c.392-362A>C
            7.

            rs6048 [Homo sapiens]
              AACTTCTAAGCTCACCCGTGCTGAG[A/G]CTGTTTTTCCTGATGTGGACTATGT
              Chromosome:
              X:139551121
              Gene:
              F9 (GeneView)
              Functional Consequence:
              missense
              Allele Origin:
              G(germline)/A(germline)
              Clinical significance:
              other
              Validated:
              by 1000G,by cluster,by frequency,by hapmap,by submitter
              Global MAF:
              G=0.1457/550
              HGVS:
              NC_000023.10:g.138633280A>G, NC_000023.11:g.139551121A>G, NG_007994.1:g.25386A>G, NM_000133.3:c.580A>G, NM_001313913.1:c.466A>G, NP_000124.1:p.Thr194Ala, NP_001300842.1:p.Thr156Ala, XM_005262396.1:c.466A>G, XM_005262397.1:c.451A>G, XM_005262397.4:c.451A>G, XP_005262453.1:p.Thr156Ala, XP_005262454.1:p.Thr151Ala

              Display Settings:

              Format
              Items per page
              Sort by

              Send to:

              Choose Destination

              Supplemental Content

              Find related data

              Recent activity

              Your browsing activity is empty.

              Activity recording is turned off.

              Turn recording back on

              See more...
              Support Center