Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 20

1.

rs17779700 [Homo sapiens]
    TTTTGTAAATCAGCGATGCCAATGG[A/G]ATGAATTCTGCACCGAAAGGGAAGG
    Chromosome:
    5:137237104
    Gene:
    SPOCK1 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    G=0.1615/809
    HGVS:
    NC_000005.10:g.137237104A>G, NC_000005.9:g.136572793A>G, NG_034127.1:g.267226T>C, NM_004598.3:c.232+29906T>C, XM_005272067.1:c.241+29906T>C, XM_005272068.1:c.-204+29906T>C
    2.

    rs17217831 [Homo sapiens]
      TCTCAGATTTACCTTGAGAAATGCC[A/C]ATCGGCCTGTATATTCACATCTTCA
      Chromosome:
      3:46263950
      Gene:
      CCR3 (GeneView)
      Functional Consequence:
      intron variant,utr variant 5 prime
      Validated:
      by 1000G,by cluster,by frequency,by hapmap
      Global MAF:
      A=0.0845/423
      HGVS:
      NC_000003.11:g.46305441C>A, NC_000003.12:g.46263950C>A, NM_001164680.1:c.-17-437C>A, NM_001837.3:c.-11-1198C>A, NM_178328.1:c.-17-437C>A, NM_178329.2:c.-11-1198C>A, XM_006712960.3:c.-11-1198C>A, XM_011533335.2:c.-11-1198C>A, XM_017005685.1:c.-352C>A, XM_017005686.1:c.-352C>A
      3.

      rs13357391 [Homo sapiens]
        CTGAAAACACCAACAGTCTCAACTC[C/T]GCTTAAAAGAAAAGTAGCCACACAT
        Chromosome:
        5:137105393
        Gene:
        SPOCK1 (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by 1000G,by cluster,by frequency,by hapmap
        Global MAF:
        C=0.2107/1055
        HGVS:
        NC_000005.10:g.137105393T>C, NC_000005.9:g.136441082T>C, NG_034127.1:g.398937A>G, NM_004598.3:c.474+7042A>G, XM_005272067.1:c.483+7042A>G, XM_005272068.1:c.39+7042A>G
        4.

        rs13084656 [Homo sapiens]
          caacacaaaacttgccaagtcacag[A/C/G]gtagtcaaggcactctctatttctc
          Chromosome:
          3:46238703
          Gene:
          CCR3 (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
          Global MAF:
          G=0.4014/2010
          HGVS:
          NC_000003.11:g.46280194C>G, NC_000003.12:g.46238703C>A, NC_000003.12:g.46238703C>G, XM_006712960.3:c.-67-3699C>A, XM_006712960.3:c.-67-3699C>G, XM_011533335.2:c.-148-3699C>A, XM_011533335.2:c.-148-3699C>G, XM_017005686.1:c.-965-3699C>A, XM_017005686.1:c.-965-3699C>G
          5.

          rs13067058 [Homo sapiens]
            AAGCTAATTTGAACATGAAGGTTAC[A/G]TCTGTCCAGATCTCTAAAAGCAGCC
            Chromosome:
            3:46232275
            Gene:
            CCR3 (GeneView)
            Functional Consequence:
            intron variant
            Validated:
            by 1000G,by cluster,by frequency,by hapmap
            Global MAF:
            A=0.0793/397
            HGVS:
            NC_000003.11:g.46273766G>A, NC_000003.12:g.46232275G>A, XM_006712960.3:c.-67-10127G>A, XM_011533335.2:c.-148-10127G>A, XM_017005686.1:c.-965-10127G>A
            6.

            rs12653349 [Homo sapiens]
              CATCTGCTAGAAAGGTGGATGGCTA[A/G]TGTCTGGTCAGACCAAACAACAGAT
              Chromosome:
              5:137229559
              Gene:
              SPOCK1 (GeneView)
              Functional Consequence:
              intron variant
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
              Global MAF:
              G=0.1607/805
              HGVS:
              NC_000005.10:g.137229559A>G, NC_000005.9:g.136565248A>G, NG_034127.1:g.274771T>C, NM_004598.3:c.232+37451T>C, XM_005272067.1:c.241+37451T>C, XM_005272068.1:c.-204+37451T>C
              7.

              rs10054991 [Homo sapiens]
                TTTGGAAAGAGGAACAGCATAGCTC[A/G]GCACTGTTTGTTAAGTTCAGTCTCC
                Chromosome:
                5:137224123
                Gene:
                SPOCK1 (GeneView)
                Functional Consequence:
                intron variant
                Validated:
                by 1000G,by cluster,by frequency,by hapmap
                Global MAF:
                G=0.1597/800
                HGVS:
                NC_000005.10:g.137224123A>G, NC_000005.9:g.136559812A>G, NG_034127.1:g.280207T>C, NM_004598.3:c.232+42887T>C, XM_005272067.1:c.241+42887T>C, XM_005272068.1:c.-204+42887T>C
                8.

                rs7701979 [Homo sapiens]
                  ACTTAAGGCATTGTATCCAGTCAAC[A/G/T]GAAAGGAGCCAGTCAAGCTAATCAA
                  Chromosome:
                  5:137099794
                  Gene:
                  SPOCK1 (GeneView)
                  Functional Consequence:
                  intron variant
                  Validated:
                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                  Global MAF:
                  T=0.2017/1010
                  HGVS:
                  NC_000005.10:g.137099794G>A, NC_000005.10:g.137099794G>T, NC_000005.9:g.136435483G>T, NG_034127.1:g.404536C>A, NG_034127.1:g.404536C>T, NM_004598.3:c.474+12641C>A, NM_004598.3:c.474+12641C>T, XM_005272067.1:c.483+12641C>A, XM_005272068.1:c.39+12641C>A
                  9.

                  rs6441948 [Homo sapiens]
                    GGAGAGGAAATTGAGAAAGGGGAGA[A/G]TAAAAGAAACTTTACATTtgtcaaa
                    Chromosome:
                    3:46254286
                    Gene:
                    CCR3 (GeneView)
                    Functional Consequence:
                    intron variant
                    Validated:
                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                    Global MAF:
                    A=0.2957/1481
                    HGVS:
                    NC_000003.11:g.46295777A>G, NC_000003.12:g.46254286A>G, NM_001164680.1:c.-17-10101A>G, NM_001837.3:c.-90-7979A>G, NM_178328.1:c.-17-10101A>G, NM_178329.2:c.-11-10862A>G, XM_006712960.3:c.-11-10862A>G, XM_011533335.2:c.-11-10862A>G, XM_017005685.1:c.-909-9107A>G, XM_017005686.1:c.-909-9107A>G
                    11.

                    rs3091312 [Homo sapiens]
                      TCATCAGAAGCACCTGGAAGTTGTG[A/T]GAAAATGTGGATGGCTGGACCCCAC
                      Chromosome:
                      3:46266981
                      Gene:
                      CCR3 (GeneView)
                      Functional Consequence:
                      downstream variant 500B
                      Validated:
                      by 1000G,by cluster,by frequency,by hapmap
                      Global MAF:
                      A=0.3431/1718
                      HGVS:
                      NC_000003.11:g.46308472T>A, NC_000003.12:g.46266981T>A, NM_001164680.1:c.*755T>A, NM_001837.3:c.*755T>A, NM_178328.1:c.*755T>A, NM_178329.2:c.*755T>A, XM_006712960.3:c.*755T>A, XM_011533335.2:c.*755T>A, XM_017005685.1:c.*755T>A, XM_017005686.1:c.*755T>A
                      12.

                      rs3091309 [Homo sapiens]
                        CCTTACCAGATGGGATGGCCAGTGC[A/G]GTTAAGTTGGTGGTCAGGCAGAAAA
                        Chromosome:
                        3:46261693
                        Gene:
                        CCR3 (GeneView)
                        Functional Consequence:
                        intron variant
                        Validated:
                        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                        Global MAF:
                        A=0.0567/284
                        HGVS:
                        NC_000003.11:g.46303184A>G, NC_000003.12:g.46261693A>G, NM_001164680.1:c.-17-2694A>G, NM_001837.3:c.-90-572A>G, NM_178328.1:c.-17-2694A>G, NM_178329.2:c.-11-3455A>G, XM_006712960.3:c.-11-3455A>G, XM_011533335.2:c.-11-3455A>G, XM_017005685.1:c.-909-1700A>G, XM_017005686.1:c.-909-1700A>G
                        13.

                        rs2373156 [Homo sapiens]
                          acaaccacttgaaaaattgtttagc[A/T]gtatgtaaagctaaacatgtgcttt
                          Chromosome:
                          3:46224888
                          Gene:
                          CCR3 (GeneView)
                          Functional Consequence:
                          intron variant
                          Validated:
                          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                          Global MAF:
                          T=0.1951/977
                          HGVS:
                          NC_000003.11:g.46266379A>T, NC_000003.12:g.46224888A>T, XM_006712960.3:c.-68+13981A>T, XM_011533335.2:c.-149+13981A>T, XM_017005686.1:c.-966+13981A>T
                          14.

                          rs2348186 [Homo sapiens]
                            CAGCTTGTCAGGTCTAGATTCCATG[C/T]GTGTGAAGATTGCTGGGGGTCAGGG
                            Chromosome:
                            5:137088070
                            Gene:
                            SPOCK1 (GeneView)
                            Functional Consequence:
                            intron variant
                            Validated:
                            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                            Global MAF:
                            C=0.3500/1753
                            HGVS:
                            NC_000005.10:g.137088070T>C, NC_000005.9:g.136423759T>C, NG_034127.1:g.416260A>G, NM_004598.3:c.475-20241A>G, XM_005272067.1:c.484-20241A>G, XM_005272068.1:c.40-20241A>G
                            15.

                            rs2157056 [Homo sapiens]
                              GGAAGTCAAATAAAATATATACAAG[A/G]AGAAGGATTCTGGGAGACAGAGTTT
                              Chromosome:
                              3:46324292
                              Validated:
                              by 1000G,by cluster,by frequency,by hapmap
                              Global MAF:
                              A=0.1631/817
                              HGVS:
                              NC_000003.11:g.46365783G>A, NC_000003.12:g.46324292G>A
                              16.

                              rs1859345 [Homo sapiens]
                                CCTCCCTGCCTGTAAATCCTATTAT[C/T]AGAGCTTAGGTGAAATGCCCCTCTA
                                Chromosome:
                                5:137111731
                                Gene:
                                SPOCK1 (GeneView)
                                Functional Consequence:
                                intron variant
                                Validated:
                                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                                Global MAF:
                                C=0.2115/1059
                                HGVS:
                                NC_000005.10:g.137111731T>C, NC_000005.9:g.136447420T>C, NG_034127.1:g.392599A>G, NM_004598.3:c.474+704A>G, XM_005272067.1:c.483+704A>G, XM_005272068.1:c.39+704A>G
                                17.

                                rs1779700 [Homo sapiens]
                                  gatcacgccactgcactccagcctt[C/G]ggacagagtgagactgtcaaaaaca
                                  Chromosome:
                                  12:31830164
                                  Validated:
                                  by 1000G,by cluster,by frequency,by hapmap
                                  Global MAF:
                                  C=0.0106/53
                                  HGVS:
                                  NC_000012.11:g.31983098C>G, NC_000012.12:g.31830164C>G
                                  18.

                                  rs1491962 [Homo sapiens]
                                    CAAAAGGTTCTATGGTTTATCATCC[C/T]GATCATGTTGATTTTATAGAAATAA
                                    Chromosome:
                                    3:46263115
                                    Gene:
                                    CCR3 (GeneView)
                                    Functional Consequence:
                                    intron variant
                                    Validated:
                                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                                    Global MAF:
                                    C=0.3634/1820
                                    HGVS:
                                    NC_000003.11:g.46304606C>T, NC_000003.12:g.46263115C>T, NM_001164680.1:c.-17-1272C>T, NM_001837.3:c.-12+772C>T, NM_178328.1:c.-17-1272C>T, NM_178329.2:c.-11-2033C>T, XM_006712960.3:c.-11-2033C>T, XM_011533335.2:c.-11-2033C>T, XM_017005685.1:c.-909-278C>T, XM_017005686.1:c.-909-278C>T
                                    19.

                                    rs1388604 [Homo sapiens]
                                      TGTAGGAAGTGCGCCTCCAATGCTA[A/T]CCATGATAGCATGTGTTGTTATGTC
                                      Chromosome:
                                      3:46235387
                                      Gene:
                                      CCR3 (GeneView)
                                      Functional Consequence:
                                      intron variant
                                      Validated:
                                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                      Global MAF:
                                      A=0.3209/1607
                                      HGVS:
                                      NC_000003.11:g.46276878T>A, NC_000003.12:g.46235387T>A, XM_006712960.3:c.-67-7015T>A, XM_011533335.2:c.-148-7015T>A, XM_017005686.1:c.-965-7015T>A
                                      20.

                                      rs1027241 [Homo sapiens]
                                        TTCAAGGGCATCTGTCATTGCCCAA[C/T]GTCACACTAGGCATCACCAGAGCAG
                                        Chromosome:
                                        3:46271048
                                        Validated:
                                        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                        Global MAF:
                                        A=0.3678/1842
                                        HGVS:
                                        NC_000003.11:g.46312539A>G, NC_000003.12:g.46271048A>G

                                        Display Settings:

                                        Format
                                        Items per page
                                        Sort by

                                        Send to:

                                        Choose Destination

                                        Supplemental Content

                                        Find related data

                                        Recent activity

                                        Your browsing activity is empty.

                                        Activity recording is turned off.

                                        Turn recording back on

                                        See more...
                                        Support Center