Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 7

2.

rs72554080 [Homo sapiens]
    ATGTTAGCACTTTTCCTTAAAGACA[A/G]CAAGGTAAGAAAGTAGGAAAAGAGT
    Chromosome:
    2:232747740
    Gene:
    GIGYF2 (GeneView)
    Functional Consequence:
    missense,nc transcript variant
    Allele Origin:
    G(germline)/A(germline)
    Clinical significance:
    other
    Validated:
    by cluster,by frequency
    HGVS:
    NC_000002.11:g.233612450A>G, NC_000002.12:g.232747740A>G, NG_011847.1:g.55436A>G, NM_001103146.1:c.167A>G, NM_001103147.1:c.167A>G, NM_001103148.1:c.167A>G, NM_015575.3:c.167A>G, NP_001096616.1:p.Asn56Ser, NP_001096617.1:p.Asn56Ser, NP_001096618.1:p.Asn56Ser, NP_056390.2:p.Asn56Ser, NR_103492.1:n.280A>G
    4.
    5.

    rs3816334 [Homo sapiens]
      TGAAAGCTCTTCAGCAGCAGCAGCA[A/G]CAGCAACAGCAGAAACTCTCAGGTT
      Chromosome:
      2:232844096
      Gene:
      GIGYF2 (GeneView)
      Functional Consequence:
      nc transcript variant,synonymous codon
      Validated:
      by 1000G,by cluster,by frequency,by hapmap
      Global MAF:
      A=0.3596/1801
      HGVS:
      NC_000002.11:g.233708806A>G, NC_000002.12:g.232844096A>G, NG_011847.1:g.151792A>G, NM_001103146.1:c.2940A>G, NM_001103147.1:c.3003A>G, NM_001103148.1:c.2922A>G, NM_015575.3:c.2940A>G, NP_001096616.1:p.Gln980, NP_001096617.1:p.Gln1001, NP_001096618.1:p.Gln974, NP_056390.2:p.Gln980, NR_103492.1:n.3053A>G
      6.

      rs2305138 [Homo sapiens]
        GAATCGACACTCCTTTAGCTCTGTG[C/T]TCTTGCAGTTTTGATGCCAATCTTT
        Chromosome:
        2:232796136
        Gene:
        GIGYF2 (GeneView)
        Functional Consequence:
        nc transcript variant,synonymous codon
        Validated:
        by 1000G,by cluster,by frequency,by hapmap
        Global MAF:
        A=0.1050/526
        HGVS:
        NC_000002.11:g.233660846G>A, NC_000002.12:g.232796136G>A, NG_011847.1:g.103832G>A, NM_001103146.1:c.1554G>A, NM_001103147.1:c.1617G>A, NM_001103148.1:c.1536G>A, NM_015575.3:c.1554G>A, NP_001096616.1:p.Glu518, NP_001096617.1:p.Glu539, NP_001096618.1:p.Glu512, NP_056390.2:p.Glu518, NR_103492.1:n.1667G>A
        7.

        rs2289912 [Homo sapiens]
          GGTGTTTCAACTGGCCGGAGAGTAG[G/T]ACTAGGATTGGGAACAGGAGGTGGA
          Chromosome:
          2:232794843
          Gene:
          GIGYF2 (GeneView)
          Functional Consequence:
          missense,nc transcript variant
          Validated:
          by 1000G,by cluster,by frequency,by hapmap
          Global MAF:
          A=0.0831/416
          HGVS:
          NC_000002.11:g.233659553C>A, NC_000002.12:g.232794843C>A, NG_011847.1:g.102539C>A, NM_001103146.1:c.1378C>A, NM_001103147.1:c.1441C>A, NM_001103148.1:c.1360C>A, NM_015575.3:c.1378C>A, NP_001096616.1:p.Pro460Thr, NP_001096617.1:p.Pro481Thr, NP_001096618.1:p.Pro454Thr, NP_056390.2:p.Pro460Thr, NR_103492.1:n.1491C>A

          Display Settings:

          Format
          Items per page
          Sort by

          Send to:

          Choose Destination

          Supplemental Content

          Find related data

          Recent activity

          Your browsing activity is empty.

          Activity recording is turned off.

          Turn recording back on

          See more...
          Support Center