Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 18

1.

Error occurred: cannot get document summary

3.

Error occurred: cannot get document summary

4.

rs11200014 [Homo sapiens]
    CCAAAAAAAGATGCACAGAGGGAAG[A/G/T]TTTTCTCTCTGGTCCCAACACGTGT
    Chromosome:
    10:121575416
    Gene:
    FGFR2 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    A=0.3131/1568
    HGVS:
    NC_000010.10:g.123334930G>A, NC_000010.11:g.121575416G>A, NC_000010.11:g.121575416G>T, NG_012449.2:g.28043C>A, NG_012449.2:g.28043C>T, NM_000141.4:c.110-9712C>A, NM_000141.4:c.110-9712C>T, NM_001144913.1:c.110-9712C>A, NM_001144913.1:c.110-9712C>T, NM_001144914.1:c.110-9712C>A, NM_001144914.1:c.110-9712C>T, NM_001144915.1:c.110-10837C>A, NM_001144915.1:c.110-10837C>T, NM_001144916.1:c.109+18293C>A, NM_001144916.1:c.109+18293C>T, NM_001144917.1:c.110-9712C>A, NM_001144917.1:c.110-9712C>T, NM_001144918.1:c.109+18293C>A, NM_001144918.1:c.109+18293C>T, NM_001144919.1:c.110-10837C>A, NM_001144919.1:c.110-10837C>T, NM_001320658.1:c.110-9712C>A, NM_001320658.1:c.110-9712C>T, NM_022970.3:c.110-9712C>A, NM_022970.3:c.110-9712C>T, NM_023029.2:c.110-10837C>A, NM_023029.2:c.110-10837C>T, NR_073009.1:n.756+18293C>A, NR_073009.1:n.756+18293C>T, XM_006717708.2:c.167-9712C>A, XM_006717708.2:c.167-9712C>T, XM_006717710.3:c.167-9712C>A, XM_006717710.3:c.167-9712C>T, XM_006717711.2:c.167-10837C>A, XM_006717711.2:c.167-10837C>T, XM_006717712.2:c.166+18293C>A, XM_006717712.2:c.166+18293C>T, XM_017015920.1:c.167-9712C>A, XM_017015920.1:c.167-9712C>T, XM_017015921.1:c.167-9712C>A, XM_017015921.1:c.167-9712C>T, XM_017015922.1:c.167-10837C>A, XM_017015922.1:c.167-10837C>T, XM_017015923.1:c.167-10837C>A, XM_017015923.1:c.167-10837C>T, XM_017015924.1:c.166+18293C>A, XM_017015924.1:c.166+18293C>T, XM_017015925.1:c.166+18293C>A, XM_017015925.1:c.166+18293C>T
    10.

    rs2981578 [Homo sapiens]
      AGCTTTTACCTCTATGCAAATATGC[A/G/T]GTTTGGAGCAGGGAAGAAAGGTTAA
      Chromosome:
      10:121580797
      Gene:
      FGFR2 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      T=0.3720/1863
      HGVS:
      NC_000010.10:g.123340311C>T, NC_000010.11:g.121580797C>A, NC_000010.11:g.121580797C>T, NG_012449.2:g.22662G>A, NG_012449.2:g.22662G>T, NM_000141.4:c.109+12912G>A, NM_000141.4:c.109+12912G>T, NM_001144913.1:c.109+12912G>A, NM_001144913.1:c.109+12912G>T, NM_001144914.1:c.109+12912G>A, NM_001144914.1:c.109+12912G>T, NM_001144915.1:c.109+12912G>A, NM_001144915.1:c.109+12912G>T, NM_001144916.1:c.109+12912G>A, NM_001144916.1:c.109+12912G>T, NM_001144917.1:c.109+12912G>A, NM_001144917.1:c.109+12912G>T, NM_001144918.1:c.109+12912G>A, NM_001144918.1:c.109+12912G>T, NM_001144919.1:c.109+12912G>A, NM_001144919.1:c.109+12912G>T, NM_001320658.1:c.109+12912G>A, NM_001320658.1:c.109+12912G>T, NM_022970.3:c.109+12912G>A, NM_022970.3:c.109+12912G>T, NM_023029.2:c.109+12912G>A, NM_023029.2:c.109+12912G>T, NR_073009.1:n.756+12912G>A, NR_073009.1:n.756+12912G>T, XM_006717708.2:c.166+12912G>A, XM_006717708.2:c.166+12912G>T, XM_006717710.3:c.166+12912G>A, XM_006717710.3:c.166+12912G>T, XM_006717711.2:c.166+12912G>A, XM_006717711.2:c.166+12912G>T, XM_006717712.2:c.166+12912G>A, XM_006717712.2:c.166+12912G>T, XM_017015920.1:c.166+12912G>A, XM_017015920.1:c.166+12912G>T, XM_017015921.1:c.166+12912G>A, XM_017015921.1:c.166+12912G>T, XM_017015922.1:c.166+12912G>A, XM_017015922.1:c.166+12912G>T, XM_017015923.1:c.166+12912G>A, XM_017015923.1:c.166+12912G>T, XM_017015924.1:c.166+12912G>A, XM_017015924.1:c.166+12912G>T, XM_017015925.1:c.166+12912G>A, XM_017015925.1:c.166+12912G>T
      16.

      rs2912774 [Homo sapiens]
        TTGATTTTTGGGTGCCTGGCTGTTA[A/C/T]GCTAGGTAGGAAATATAGCTGGTGT
        Chromosome:
        10:121589148
        Gene:
        FGFR2 (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
        Global MAF:
        T=0.4623/2315
        HGVS:
        NC_000010.10:g.123348662T>G, NC_000010.11:g.121589148T>A, NC_000010.11:g.121589148T>G, NG_012449.2:g.14311A>C, NG_012449.2:g.14311A>T, NM_000141.4:c.109+4561A>C, NM_000141.4:c.109+4561A>T, NM_001144913.1:c.109+4561A>C, NM_001144913.1:c.109+4561A>T, NM_001144914.1:c.109+4561A>C, NM_001144914.1:c.109+4561A>T, NM_001144915.1:c.109+4561A>C, NM_001144915.1:c.109+4561A>T, NM_001144916.1:c.109+4561A>C, NM_001144916.1:c.109+4561A>T, NM_001144917.1:c.109+4561A>C, NM_001144917.1:c.109+4561A>T, NM_001144918.1:c.109+4561A>C, NM_001144918.1:c.109+4561A>T, NM_001144919.1:c.109+4561A>C, NM_001144919.1:c.109+4561A>T, NM_001320658.1:c.109+4561A>C, NM_001320658.1:c.109+4561A>T, NM_022970.3:c.109+4561A>C, NM_022970.3:c.109+4561A>T, NM_023029.2:c.109+4561A>C, NM_023029.2:c.109+4561A>T, NR_073009.1:n.756+4561A>C, NR_073009.1:n.756+4561A>T, XM_006717708.2:c.166+4561A>C, XM_006717708.2:c.166+4561A>T, XM_006717710.3:c.166+4561A>C, XM_006717710.3:c.166+4561A>T, XM_006717711.2:c.166+4561A>C, XM_006717711.2:c.166+4561A>T, XM_006717712.2:c.166+4561A>C, XM_006717712.2:c.166+4561A>T, XM_017015920.1:c.166+4561A>C, XM_017015920.1:c.166+4561A>T, XM_017015921.1:c.166+4561A>C, XM_017015921.1:c.166+4561A>T, XM_017015922.1:c.166+4561A>C, XM_017015922.1:c.166+4561A>T, XM_017015923.1:c.166+4561A>C, XM_017015923.1:c.166+4561A>T, XM_017015924.1:c.166+4561A>C, XM_017015924.1:c.166+4561A>T, XM_017015925.1:c.166+4561A>C, XM_017015925.1:c.166+4561A>T

        Display Settings:

        Format
        Items per page
        Sort by

        Send to:

        Choose Destination

        Supplemental Content

        Find related data

        Recent activity

        Your browsing activity is empty.

        Activity recording is turned off.

        Turn recording back on

        See more...
        Support Center