Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 16

1.

rs17116138 [Homo sapiens]
    GTTTGTGTTGTTTGCAGTGGAAGAC[A/G]TAGACCTGGCCTTTCTGAGGAGCCC
    Chromosome:
    11:113932944
    Gene:
    HTR3B (GeneView)
    Functional Consequence:
    missense,nc transcript variant
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    A=0.0453/227
    HGVS:
    NC_000011.10:g.113932944G>A, NC_000011.9:g.113803666G>A, NG_011483.1:g.33078G>A, NM_006028.4:c.547G>A, NP_006019.1:p.Val183Ile, XM_011543063.1:c.514G>A, XM_017018552.1:c.340G>A, XP_011541365.1:p.Val172Ile, XP_016874041.1:p.Val114Ile, XR_001748034.1:n.798G>A
    2.

    rs17116121 [Homo sapiens]
      TATAAGCAGAGAAATCCAAACATAC[A/G]GTAACTTAACAGGAATGGCTGCCAA
      Chromosome:
      11:113930946
      Gene:
      HTR3B (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by cluster,by frequency,by hapmap
      Global MAF:
      A=0.0453/227
      HGVS:
      NC_000011.10:g.113930946G>A, NC_000011.9:g.113801668G>A, NG_011483.1:g.31080G>A, NM_006028.4:c.214-438G>A, XM_011543063.1:c.181-438G>A, XM_017018552.1:c.7-438G>A, XR_001748034.1:n.465-438G>A
      3.

      rs11606194 [Homo sapiens]
        AATTTGTTTATTAAAGCATCCTTTT[C/T]CTCCTATGTCTGAAAGATGGGCTGT
        Chromosome:
        11:113910259
        Gene:
        HTR3B (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        C=0.0365/183
        HGVS:
        NC_000011.10:g.113910259T>C, NC_000011.9:g.113780981T>C, NG_011483.1:g.10393T>C, NM_006028.4:c.213+804T>C, XM_011543063.1:c.180+804T>C, XR_001748034.1:n.464+804T>C
        4.

        rs10502180 [Homo sapiens]
          CTTTCCATCAAAGTGCCCTGAACAC[G/T]TTAAGATAGGTGCATGGGAGAGTAA
          Chromosome:
          11:113907040
          Gene:
          HTR3B (GeneView)
          Functional Consequence:
          intron variant,upstream variant 2KB
          Validated:
          by 1000G,by cluster,by frequency,by hapmap
          Global MAF:
          G=0.1054/528
          HGVS:
          NC_000011.10:g.113907040T>G, NC_000011.9:g.113777762T>G, NG_011483.1:g.7174T>G, NM_006028.4:c.52+2055T>G, XM_011543063.1:c.-2236T>G, XR_001748034.1:n.-1952T>G
          5.

          rs3782025 [Homo sapiens]
            AGAGCTCCTTGGAGATGGAATAGGC[C/T]CCAAGGTTAGCCTGTAATTGCCTCC
            Chromosome:
            11:113936885
            Gene:
            HTR3B (GeneView)
            Functional Consequence:
            intron variant
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
            Global MAF:
            G=0.3968/1987
            HGVS:
            NC_000011.10:g.113936885G>A, NC_000011.9:g.113807607G>A, NG_011483.1:g.37019G>A, NM_006028.4:c.696+3792G>A, XM_011543063.1:c.663+3792G>A, XM_017018552.1:c.489+3792G>A, XR_001748034.1:n.947+3792G>A
            6.

            rs3758987 [Homo sapiens]
              CTTTACAGCCTTTACCTAAGGCAGT[A/G]CTCTTGCTGACATTCAGGACACTAA
              Chromosome:
              11:113904553
              Gene:
              HTR3B (GeneView)
              Functional Consequence:
              upstream variant 2KB
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
              Global MAF:
              C=0.3267/1636
              HGVS:
              NC_000011.10:g.113904553T>C, NC_000011.9:g.113775275T>C, NG_011483.1:g.4687T>C, NM_006028.4:c.-381T>C
              7.

              rs3737457 [Homo sapiens]
                CTAAGATAGGAAGGTTGGAAAAACC[A/G]AGGCCAGGCAAAACATCCAGGTTAT
                Chromosome:
                11:113982977
                Gene:
                HTR3A (GeneView)
                Functional Consequence:
                intron variant
                Validated:
                by 1000G,by cluster,by frequency,by hapmap
                Global MAF:
                A=0.1288/645
                HGVS:
                NC_000011.10:g.113982977G>A, NC_000011.9:g.113853699G>A, NG_013058.1:g.12903G>A, NM_000869.5:c.393-143G>A, NM_001161772.2:c.330-143G>A, NM_213621.3:c.393-143G>A, NR_046363.1:n.626-143G>A
                8.

                rs2276307 [Homo sapiens]
                  TTGGCCTTCTCTCTTGGGCCAAGGA[A/G]TTTCTGCTCTATTGCATGTTCTCAT
                  Chromosome:
                  11:113933165
                  Gene:
                  HTR3B (GeneView)
                  Functional Consequence:
                  intron variant
                  Validated:
                  by 1000G,by cluster,by frequency,by hapmap,by submitter
                  Global MAF:
                  G=0.2117/1060
                  HGVS:
                  NC_000011.10:g.113933165A>G, NC_000011.9:g.113803887A>G, NG_011483.1:g.33299A>G, NM_006028.4:c.696+72A>G, XM_011543063.1:c.663+72A>G, XM_017018552.1:c.489+72A>G, XR_001748034.1:n.947+72A>G
                  9.

                  rs2276302 [Homo sapiens]
                    CCTCAGCCTGAGATCCAGGAGTGTG[A/G]AATCTCCTCATCTCAGGTCTGAGAG
                    Chromosome:
                    11:113979418
                    Gene:
                    HTR3A (GeneView)
                    Functional Consequence:
                    intron variant
                    Validated:
                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                    Global MAF:
                    G=0.3001/1503
                    HGVS:
                    NC_000011.10:g.113979418G>A, NC_000011.9:g.113850140G>A, NG_013058.1:g.9344G>A, NM_000869.5:c.282+141G>A, NM_001161772.2:c.219+141G>A, NM_213621.3:c.282+141G>A, NR_046363.1:n.515+141G>A
                    10.

                    rs1176761 [Homo sapiens]
                      TCATAGCCAGGAATTCTCCCCGAAG[A/T]CCCAACGTTTTTGCATAATGTGAAA
                      Chromosome:
                      11:113942891
                      Gene:
                      HTR3B (GeneView)
                      Functional Consequence:
                      intron variant
                      Validated:
                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                      Global MAF:
                      A=0.0781/391
                      HGVS:
                      NC_000011.10:g.113942891T>A, NC_000011.9:g.113813613T>A, NG_011483.1:g.43025T>A, NM_006028.4:c.697-91T>A, XM_011543063.1:c.664-91T>A, XM_017018552.1:c.490-91T>A, XR_001748034.1:n.948-1682T>A
                      11.

                      rs1176744 [Homo sapiens]
                        CACATAAACATAGGGAAGGTCAGGG[G/T]ATCTTTCAATGTCCACACTATATGA
                        Chromosome:
                        11:113932306
                        Gene:
                        HTR3B (GeneView)
                        Functional Consequence:
                        missense,nc transcript variant
                        Validated:
                        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                        Global MAF:
                        C=0.3544/1775
                        HGVS:
                        NC_000011.10:g.113932306A>C, NC_000011.9:g.113803028A>C, NG_011483.1:g.32440A>C, NM_006028.4:c.386A>C, NP_006019.1:p.Tyr129Ser, XM_011543063.1:c.353A>C, XM_017018552.1:c.179A>C, XP_011541365.1:p.Tyr118Ser, XP_016874041.1:p.Tyr60Ser, XR_001748034.1:n.637A>C
                        12.

                        rs1176724 [Homo sapiens]
                          TATGGGCAAACATGATGGGCTTAGA[A/T]AGGTGGTTGGGGCGAGGTGTGGAGG
                          Chromosome:
                          11:113977078
                          Gene:
                          HTR3A (GeneView)
                          Functional Consequence:
                          intron variant,upstream variant 2KB
                          Validated:
                          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                          Global MAF:
                          A=0.1044/523
                          HGVS:
                          NC_000011.10:g.113977078A>T, NC_000011.9:g.113847800A>T, NG_013058.1:g.7004A>T, NM_000869.5:c.86-693A>T, NM_001161772.2:c.-477A>T, NM_213621.3:c.86-693A>T, NR_046363.1:n.319-693A>T
                          13.

                          rs1176713 [Homo sapiens]
                            GGGTGATGCTGTAGGCCAGCACCGC[C/T]AGCAGGTAAATGTGGAATAGCAGCT
                            Chromosome:
                            11:113989703
                            Gene:
                            HTR3A (GeneView)
                            Functional Consequence:
                            nc transcript variant,synonymous codon
                            Validated:
                            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                            Global MAF:
                            G=0.2770/1387
                            HGVS:
                            NC_000011.10:g.113989703A>G, NC_000011.9:g.113860425A>G, NG_013058.1:g.19629A>G, NM_000869.5:c.1395A>G, NM_001161772.2:c.1332A>G, NM_213621.3:c.1491A>G, NP_000860.2:p.Leu465, NP_001155244.1:p.Leu444, NP_998786.2:p.Leu497, NR_046363.1:n.1467A>G
                            14.

                            rs1150226 [Homo sapiens]
                              CAGGCAGGAGCAGGAAGACCATTCT[C/T]TTACTCCCCAGGGTGACATAACCAA
                              Chromosome:
                              11:113974819
                              Gene:
                              HTR3A (GeneView)
                              Functional Consequence:
                              upstream variant 2KB
                              Validated:
                              by 1000G,by cluster,by frequency,by hapmap,by submitter
                              Global MAF:
                              A=0.1198/600
                              HGVS:
                              NC_000011.10:g.113974819A>G, NC_000011.9:g.113845541A>G, NG_013058.1:g.4745A>G, NM_000869.5:c.-489A>G, NM_213621.3:c.-489A>G, NR_046363.1:n.-256A>G
                              15.

                              rs897692 [Homo sapiens]
                                TTTTCCAGGTTAAAACACAGAGCCC[A/C]GAGAACCTCCATGACATGCGTTAAT
                                Chromosome:
                                11:113971428
                                Validated:
                                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                Global MAF:
                                T=0.1214/608
                                HGVS:
                                NC_000011.10:g.113971428T>G, NC_000011.9:g.113842150T>G, NG_013058.1:g.1354T>G
                                16.

                                rs897687 [Homo sapiens]
                                  TTCTACTGATAAAAGTGGTTAACTC[C/T]TGTTGTTGGTGAAGTTTGGGATTGA
                                  Chromosome:
                                  11:113985089
                                  Gene:
                                  HTR3A (GeneView)
                                  Functional Consequence:
                                  intron variant
                                  Validated:
                                  by 1000G,by cluster,by frequency,by hapmap,by submitter
                                  Global MAF:
                                  G=0.1028/515
                                  HGVS:
                                  NC_000011.10:g.113985089G>A, NC_000011.9:g.113855811G>A, NG_013058.1:g.15015G>A, NM_000869.5:c.563-926G>A, NM_001161772.2:c.500-926G>A, NM_213621.3:c.563-926G>A, NR_046363.1:n.796-1429G>A

                                  Display Settings:

                                  Format
                                  Items per page
                                  Sort by

                                  Send to:

                                  Choose Destination

                                  Supplemental Content

                                  Find related data

                                  Recent activity

                                  Your browsing activity is empty.

                                  Activity recording is turned off.

                                  Turn recording back on

                                  See more...
                                  Support Center