Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 3

1.

rs6413429 [Homo sapiens]
    TCAGGCCAGGAGGGCTCCACCCTGA[G/T]GAATGGGACCAGTGCCCTCATAAAA
    Chromosome:
    5:1446912
    Gene:
    SLC6A3 (GeneView)
    Functional Consequence:
    upstream variant 2KB
    Validated:
    by 1000G,by cluster,by frequency
    Global MAF:
    A=0.0451/226
    HGVS:
    CM000667.2:g.1446912C>A, NC_000005.10:g.1446912C>A, NC_000005.9:g.1447027C>A, NG_015885.1:g.3517G>T, NM_001044.4:c.-1610G>T, NT_187547.1:g.62861G>T
    2.

    rs6350 [Homo sapiens]
      AGCTCATCCTTGTCAAGGAGCAGAA[C/G/T]GGAGTGCAGCTCACCAGCTCCACCC
      Chromosome:
      5:1443084
      Gene:
      SLC6A3 (GeneView)
      Functional Consequence:
      missense,synonymous codon
      Validated:
      by 1000G,by cluster,by frequency
      Global MAF:
      A=0.0455/228
      HGVS:
      CM000667.2:g.1443084G>A, CM000667.2:g.1443084G>C, NC_000005.10:g.1443084G>A, NC_000005.10:g.1443084G>C, NC_000005.9:g.1443199G>A, NG_015885.1:g.7345C>G, NG_015885.1:g.7345C>T, NM_001044.4:c.114C>G, NM_001044.4:c.114C>T, NP_001035.1:p.Asn38, NP_001035.1:p.Asn38Lys, NT_187547.1:g.66689C>G, NT_187547.1:g.66689C>T
      3.

      rs6347 [Homo sapiens]
        CCATCGCCACGCTCCCTCTGTCCTC[A/G]GCCTGGGCCGTGGTCTTCTTCATCA
        Chromosome:
        5:1411297
        Gene:
        SLC6A3 (GeneView)
        Functional Consequence:
        synonymous codon
        Clinical significance:
        Benign
        Validated:
        by 1000G,by cluster,by frequency
        Global MAF:
        C=0.2985/1495
        HGVS:
        CM000667.2:g.1411297T>C, NC_000005.10:g.1411297T>C, NC_000005.9:g.1411412T>C, NG_015885.1:g.39132A>G, NM_001044.4:c.1215A>G, NP_001035.1:p.Ser405, NT_187547.1:g.102712A>G

        Display Settings:

        Format
        Sort by

        Send to:

        Choose Destination

        Supplemental Content

        Find related data

        Recent activity

        Your browsing activity is empty.

        Activity recording is turned off.

        Turn recording back on

        See more...
        Support Center