Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 12

1.

rs3758919 [Homo sapiens]
    GAAACTGACTTAATCAGGATGTTTG[C/T]GGAATTTCTCCCTAGTGTGGATGTT
    Chromosome:
    11:57595330
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    A=0.0851/426
    HGVS:
    NC_000011.10:g.57595330G>A, NC_000011.9:g.57362803G>A, NG_009625.1:g.2777G>A
    2.

    rs2511990 [Homo sapiens]
      ACTGGGAGCAGGTCTAGGATTTCTC[C/T]GTAACAAGGACCTTTCCTTCTGGTG
      Chromosome:
      11:57595235
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
      Global MAF:
      A=0.3678/1842
      HGVS:
      NC_000011.10:g.57595235A>G, NC_000011.9:g.57362708A>G, NG_009625.1:g.2682A>G
      3.

      rs2511989 [Homo sapiens]
        GGTTTAATACAGGGGTTGTCAACTC[A/G]GAGTGAATTTGCCTCTCAGTGGACA
        Chromosome:
        11:57610852
        Gene:
        SERPING1 (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        T=0.3339/1672
        HGVS:
        NC_000011.10:g.57610852C>T, NC_000011.9:g.57378325C>T, NG_009625.1:g.18299C>T, NM_000062.2:c.1030-865C>T, NM_001032295.1:c.1030-865C>T, XM_005274204.1:c.1045-865C>T, XM_005274205.1:c.1030-865C>T
        4.

        rs2511988 [Homo sapiens]
          CCCCACCTAGAAAATAAGAGATGCA[C/T]CTTAACAGTCTTCCTACCGCATCTC
          Chromosome:
          11:57611697
          Gene:
          SERPING1 (GeneView)
          Functional Consequence:
          intron variant
          Clinical significance:
          Benign
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
          Global MAF:
          G=0.4838/2423
          HGVS:
          NC_000011.10:g.57611697A>G, NC_000011.9:g.57379170A>G, NG_009625.1:g.19144A>G, NM_000062.2:c.1030-20A>G, NM_001032295.1:c.1030-20A>G, XM_005274204.1:c.1045-20A>G, XM_005274205.1:c.1030-20A>G
          5.

          rs2509897 [Homo sapiens]
            GTTGTAGGTGCACATGGCTTCTCTC[C/G]CCTGTGAATTTCCTGATGTTGAATG
            Chromosome:
            11:57595144
            Validated:
            by 1000G,by cluster,by frequency,by hapmap
            Global MAF:
            C=0.2298/1151
            HGVS:
            NC_000011.10:g.57595144C>G, NC_000011.9:g.57362617C>G, NG_009625.1:g.2591C>G
            6.

            rs2508443 [Homo sapiens]
              TATCTACTTCTTCTGGGCTATTCAG[C/G/T]TTCCGACAATTGATTGCTTTCAGTT
              Chromosome:
              11:57610519
              Gene:
              SERPING1 (GeneView)
              Functional Consequence:
              intron variant
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
              Global MAF:
              T=0.2686/1345
              HGVS:
              NC_000011.10:g.57610519G>C, NC_000011.10:g.57610519G>T, NC_000011.9:g.57377992G>T, NG_009625.1:g.17966G>C, NG_009625.1:g.17966G>T, NM_000062.2:c.1030-1198G>C, NM_000062.2:c.1030-1198G>T, NM_001032295.1:c.1030-1198G>C, NM_001032295.1:c.1030-1198G>T, XM_005274204.1:c.1045-1198G>T, XM_005274205.1:c.1030-1198G>T
              7.

              rs2244169 [Homo sapiens]
                AAGTTTTACAAAGCACGTATATGAC[A/T]TTGTAGCAATAACTTTGAAAGAATC
                Chromosome:
                11:57592329
                Validated:
                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                Global MAF:
                T=0.3684/1845
                HGVS:
                NC_000011.10:g.57592329T>A, NC_000011.9:g.57359802T>A
                8.

                rs2230199 [Homo sapiens]
                  CAGGGAGTTCAAGTCAGAAAAGGGG[A/C/G]GCAACAAGTTCGTGACCGTGCAGGC
                  Chromosome:
                  19:6718376
                  Gene:
                  C3 (GeneView)
                  Functional Consequence:
                  missense
                  Allele Origin:
                  G(germline)/C(germline)
                  Clinical significance:
                  other
                  Validated:
                  by 1000G,by cluster,by frequency,by hapmap
                  Global MAF:
                  C=0.0873/437
                  HGVS:
                  NC_000019.10:g.6718376G>C, NC_000019.10:g.6718376G>T, NC_000019.9:g.6718387G>C, NC_000019.9:g.6718387G>T, NG_009557.1:g.7276C>A, NG_009557.1:g.7276C>G, NM_000064.2:c.304C>A, NM_000064.2:c.304C>G, NM_000064.3:c.304C>A, NM_000064.3:c.304C>G, NP_000055.2:p.Arg102Gly, NP_000055.2:p.Arg102Ser
                  9.

                  rs1005511 [Homo sapiens]
                    tatactgcaaaacatcctaaaatgc[A/G]cagggtagcccctcagcaatgaatt
                    Chromosome:
                    11:57599183
                    Gene:
                    SERPING1 (GeneView)
                    Functional Consequence:
                    intron variant
                    Validated:
                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                    Global MAF:
                    C=0.4818/2413
                    HGVS:
                    NC_000011.10:g.57599183C>T, NC_000011.9:g.57366656C>T, NG_009625.1:g.6630C>T, NM_000062.2:c.52-696C>T, NM_001032295.1:c.52-696C>T, XM_005274204.1:c.52-681C>T, XM_005274205.1:c.52-696C>T
                    10.

                    rs1005510 [Homo sapiens]
                      ACAAGAGAGTAATTTCTGACAGTGC[A/G]GCAGATGAGCAATCTGTCTTAGAAC
                      Chromosome:
                      11:57599749
                      Gene:
                      SERPING1 (GeneView)
                      Functional Consequence:
                      intron variant
                      Validated:
                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                      Global MAF:
                      C=0.4908/2458
                      HGVS:
                      NC_000011.10:g.57599749C>T, NC_000011.9:g.57367222C>T, NG_009625.1:g.7196C>T, NM_000062.2:c.52-130C>T, NM_001032295.1:c.52-130C>T, XM_005274204.1:c.52-115C>T, XM_005274205.1:c.52-130C>T
                      12.

                      rs4926 [Homo sapiens]
                        TGAAGTGCAGCAGCCCTTCCTCTTC[A/G]TGCTCTGGGACCAGCAGCACAAGTT
                        Chromosome:
                        11:57614516
                        Gene:
                        SERPING1 (GeneView)
                        Functional Consequence:
                        missense
                        Clinical significance:
                        Benign
                        Validated:
                        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                        Global MAF:
                        A=0.1496/749
                        HGVS:
                        NC_000011.10:g.57614516G>A, NC_000011.9:g.57381989G>A, NG_009625.1:g.21963G>A, NM_000062.2:c.1438G>A, NM_001032295.1:c.1438G>A, NP_000053.2:p.Val480Met, NP_001027466.1:p.Val480Met, XM_005274204.1:c.1453G>A, XM_005274205.1:c.1438G>A, XP_005274261.1:p.Val485Met, XP_005274262.1:p.Val480Met

                        Display Settings:

                        Format
                        Items per page
                        Sort by

                        Send to:

                        Choose Destination

                        Supplemental Content

                        Find related data

                        Recent activity

                        Your browsing activity is empty.

                        Activity recording is turned off.

                        Turn recording back on

                        See more...
                        Support Center