Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 5

1.

rs1785437 [Homo sapiens]
    GAGATGCGGCAGGTACAGCCCCACC[C/T]GCTTTTCCACGCCCCAGCCCGGGGC
    Chromosome:
    21:44401911
    Gene:
    TRPM2 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
    Global MAF:
    C=0.2921/1463
    HGVS:
    CM000683.2:g.44401911C>T, NC_000021.8:g.45821794C>T, NC_000021.9:g.44401911C>T, NG_022913.1:g.53311C>T, NM_001320350.1:c.2538+14C>T, NM_001320351.1:c.2538+14C>T, NM_003307.3:c.2538+14C>T, NR_038257.1:n.2638+14C>T, XR_001754900.1:n.3046+14C>T, XR_001754901.1:n.3046+14C>T, XR_001754902.1:n.3044+14C>T
    4.

    rs933151 [Homo sapiens]
      GTCCACAGAAAGCCCAGTCTCCCCA[C/T]GTTGCCCCCATAATTCAGAAAGCCT
      Chromosome:
      21:44416122
      Gene:
      TRPM2-AS (GeneView) TRPM2 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      C=0.2660/1332
      HGVS:
      CM000683.2:g.44416122C>T, NC_000021.8:g.45836005C>T, NC_000021.9:g.44416122C>T, NG_022913.1:g.67522C>T, NM_001320350.1:c.3147-1805C>T, NM_001320351.1:c.3147-1805C>T, NM_003307.3:c.3147-1805C>T, NR_038257.1:n.3250-1805C>T, NR_109964.1:n.521-1178G>A, XR_001754900.1:n.3655-1805C>T, XR_001754901.1:n.3655-1805C>T, XR_001754902.1:n.3653-1805C>T, XR_244330.1:n.600-1178G>A
      5.

      rs749909 [Homo sapiens]
        GTGAGACCAAGGCTCTGGGTTAACT[C/T]GGGGTCACCTGGTGGGGGAAGGGTC
        Chromosome:
        21:44434924
        Gene:
        TRPM2 (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        G=0.1374/688
        HGVS:
        CM000683.2:g.44434924G>A, NC_000021.8:g.45854807G>A, NC_000021.9:g.44434924G>A, NG_022913.1:g.86324G>A, NM_001320350.1:c.4125-207G>A, NM_001320351.1:c.3873-207G>A, NM_001320352.1:c.18-207G>A, NM_003307.3:c.3975-207G>A, NR_038257.1:n.4078-207G>A, XR_001754900.1:n.4709-207G>A, XR_001754901.1:n.4607-207G>A

        Display Settings:

        Format
        Sort by

        Send to:

        Choose Destination

        Supplemental Content

        Find related data

        Recent activity

        Your browsing activity is empty.

        Activity recording is turned off.

        Turn recording back on

        See more...
        Support Center