Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 4

1.

rs2288087 [Homo sapiens]
    AATCATGTGCTAGGGAATTTTTGAA[A/T]TAGAAGAAATCTTGTCATCTTGTCT
    Chromosome:
    9:72929122
    Gene:
    ALDH1A1 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
    Global MAF:
    T=0.4087/2047
    HGVS:
    NC_000009.11:g.75544038A>T, NC_000009.12:g.72929122A>T, NG_012249.1:g.28932T>A, NM_000689.4:c.313-101T>A, XM_005251800.1:c.313-101T>A, XM_005251801.1:c.253-101T>A
    2.

    rs610529 [Homo sapiens]
      TATTTTTTAAATTCCATATCTGTGA[C/T]TATTAGCATTTCATTGAGCTAATGA
      Chromosome:
      9:72918408
      Gene:
      ALDH1A1 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      G=0.4333/2170
      HGVS:
      NC_000009.11:g.75533324A>G, NC_000009.12:g.72918408A>G, NG_012249.1:g.39646T>C, NM_000689.4:c.850+312T>C, XM_005251800.1:c.850+312T>C, XM_005251801.1:c.790+312T>C
      3.

      rs348479 [Homo sapiens]
        TTGACTTGTCTCAAGCACCCACAGA[G/T]AATTTTGTGGTTTGGTCTTCAGAGA
        Chromosome:
        9:72897384
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        G=0.1783/893
        HGVS:
        NC_000009.11:g.75512300T>G, NC_000009.12:g.72897384T>G
        4.

        rs348449 [Homo sapiens]
          CTGAGCTCCTGAACCCCATTGCAAG[C/T]TCCAAAAGACATGCCATGAAAATAT
          Chromosome:
          9:72940066
          Gene:
          ALDH1A1 (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
          Global MAF:
          G=0.0815/408
          HGVS:
          NC_000009.11:g.75554982G>A, NC_000009.12:g.72940066G>A, NG_012249.1:g.17988C>T, NM_000689.4:c.171+82C>T, XM_005251800.1:c.171+82C>T, XM_005251801.1:c.111+82C>T

          Display Settings:

          Format
          Sort by

          Send to:

          Choose Destination

          Supplemental Content

          Find related data

          Recent activity

          Your browsing activity is empty.

          Activity recording is turned off.

          Turn recording back on

          See more...
          Support Center