Display Settings:

Format

Send to:

Choose Destination

Links from PubMed

1.

rs157580 [Homo sapiens]
    GTCACGGTGTCAGCAAGGTGTCAGC[A/G]AGGTTCCTTGGGTATGGGACCCAAA
    Chromosome:
    19:44892009
    Gene:
    TOMM40 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    G=0.3486/1746
    HGVS:
    NC_000019.10:g.44892009G>A, NC_000019.9:g.45395266G>A, NG_042854.1:g.5790G>A, NM_001128916.1:c.274+320G>A, NM_001128917.1:c.274+320G>A, NM_006114.2:c.274+320G>A, XM_005258411.1:c.274+320G>A, XM_005258411.3:c.274+320G>A

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center