Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 1 to 20 of 57

1.

rs12404124 [Homo sapiens]
    ATGTTTTCCCATTATGAATGCTGAC[G/T]TACAAATAATCCTAATTTTGTTTAA
    Chromosome:
    1:11813812
    Gene:
    CLCN6 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    G=0.4042/2024
    HGVS:
    NC_000001.10:g.11873869G>T, NC_000001.11:g.11813812G>T, NG_008766.1:g.12663G>T, NM_001256959.1:c.148-2803G>T, NM_001286.3:c.148-2034G>T, NR_046428.1:n.315-2034G>T
    2.

    rs11656775 [Homo sapiens]
      TGTTTCCTTCCGCCTTCCACAGAGG[A/G]GGAAGATGGGTACACATGTGGCTAG
      Chromosome:
      17:17751005
      Gene:
      RAI1 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      G=0.4223/2115
      HGVS:
      NC_000017.10:g.17654319A>G, NC_000017.11:g.17751005A>G, NG_007101.2:g.74533A>G, NM_030665.3:c.-17+26846A>G, XM_017024025.1:c.-17+26846A>G, XM_017024026.1:c.-17+26846A>G, XM_017024027.1:c.-17+26846A>G
      3.

      rs11235468 [Homo sapiens]
        TAAACAATTGTATGCAACATATTAG[G/T]TAACACCGATAAAACGAACAAATTC
        Chromosome:
        11:72212498
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        G=0.2418/1211
        HGVS:
        NC_000011.10:g.72212498T>G, NC_000011.9:g.71923542T>G
        4.

        rs11040270 [Homo sapiens]
          ACTCTCCCTACTGATAGAGATTGAA[C/G]TGAAAATAAAAAAACAAGACTCAGT
          Chromosome:
          11:49144118
          Validated:
          by 1000G,by cluster,by frequency,by hapmap
          Global MAF:
          C=0.2039/1021
          HGVS:
          NC_000011.10:g.49144118G>C, NC_000011.9:g.49165670G>C
          6.

          rs7311958 [Homo sapiens]
            CCCCCCAGCTAATCTCTGCCTGGGC[C/T]ACTTAGGCACGCACAGCCTGGGCTA
            Chromosome:
            12:57219642
            Gene:
            NXPH4 (GeneView)
            Functional Consequence:
            intron variant
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
            Global MAF:
            T=0.4974/2491
            HGVS:
            NC_000012.11:g.57613425C>T, NC_000012.12:g.57219642C>T, NM_007224.3:c.57+2616C>T, XM_017018747.1:c.57+2616C>T
            7.

            rs7224617 [Homo sapiens]
              TGCAGGGCCCTGTATCAGAACAGCA[G/T]CTGGATTTACTGGATGGAAAAATCA
              Chromosome:
              17:17697265
              Gene:
              RAI1 (GeneView)
              Functional Consequence:
              intron variant
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
              Global MAF:
              G=0.4211/2109
              HGVS:
              NC_000017.10:g.17600579T>G, NC_000017.11:g.17697265T>G, NG_007101.2:g.20793T>G, NM_030665.3:c.-149+15472T>G, XM_017024025.1:c.-149+15472T>G, XM_017024026.1:c.-149+13562T>G
              8.
              11.

              rs6485963 [Homo sapiens]
                GCACCCAGCTCCAAAAATGGGGTAC[A/C]CTCTAACCACTTCTAAACCCCAGGG
                Chromosome:
                11:49137671
                Validated:
                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                Global MAF:
                C=0.1727/865
                HGVS:
                NC_000011.10:g.49137671A>C, NC_000011.9:g.49159223A>C
                13.
                14.

                rs4522809 [Homo sapiens]
                  TGTCACACCTTATTCCAGAGGTGTC[C/T]CTAGGCTACTGTGTGCGGAACGAGG
                  Chromosome:
                  3:30627192
                  Gene:
                  TGFBR2 (GeneView)
                  Functional Consequence:
                  intron variant
                  Validated:
                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                  Global MAF:
                  G=0.4469/2238
                  HGVS:
                  NC_000003.11:g.30668684A>G, NC_000003.12:g.30627192A>G, NG_007490.1:g.25691A>G, NM_001024847.2:c.169+3919A>G, NM_003242.5:c.95-17555A>G, XM_011534043.2:c.121+3919A>G, XM_011534045.2:c.-11-17555A>G
                  15.

                  rs3773634 [Homo sapiens]
                    AAGAAGACATTTGCGAATGTTTTCA[A/G]GATGCATTGTACAAGATACTGTTTT
                    Chromosome:
                    3:30656444
                    Gene:
                    LOC105377016 (GeneView) TGFBR2 (GeneView)
                    Functional Consequence:
                    intron variant,nc transcript variant
                    Validated:
                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                    Global MAF:
                    G=0.3037/1521
                    HGVS:
                    NC_000003.11:g.30697936A>G, NC_000003.12:g.30656444A>G, NG_007490.1:g.54943A>G, NM_001024847.2:c.529+5984A>G, NM_003242.5:c.454+5984A>G, XM_011534043.2:c.481+5984A>G, XM_011534045.2:c.349+5984A>G, XM_017007106.1:c.349+5984A>G, XR_001740630.1:n.2465A>G, XR_001740631.1:n.647-1263A>G
                    17.

                    rs3733890 [Homo sapiens]
                      ATGAAGGAGGGCTTGGAGGCTGCCC[A/G]ACTGAAAGCTCACCTGATGAGCCAG
                      Chromosome:
                      5:79126136
                      Gene:
                      BHMT (GeneView)
                      Functional Consequence:
                      missense
                      Validated:
                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                      Global MAF:
                      A=0.2907/1456
                      HGVS:
                      NC_000005.10:g.79126136G>A, NC_000005.9:g.78421959G>A, NG_029156.1:g.19356G>A, NM_001713.2:c.716G>A, NP_001704.2:p.Arg239Gln, XM_005248566.1:c.257G>A, XP_005248623.1:p.Arg86Gln
                      18.

                      rs3016432 [Homo sapiens]
                        atcatagccaagaaacttagatttt[A/G]aagtttttgtggggtctccttggcc
                        Chromosome:
                        11:72186211
                        Validated:
                        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                        Global MAF:
                        T=0.4357/2182
                        HGVS:
                        NC_000011.10:g.72186211C>T, NC_000011.9:g.71897255C>T, NG_015863.1:g.1654C>T
                        19.

                        rs2799103 [Homo sapiens]
                          ACTGGAGAGCTCCAAGTCCTCTGAG[A/G]TTAGCAAATTTAAATATAAGTATTC
                          Chromosome:
                          1:218411077
                          Gene:
                          TGFB2 (GeneView)
                          Functional Consequence:
                          intron variant
                          Validated:
                          by 1000G,by cluster,by frequency,by hapmap,by submitter
                          Global MAF:
                          T=0.1999/1001
                          HGVS:
                          NC_000001.10:g.218584419C>T, NC_000001.11:g.218411077C>T, NG_027721.2:g.70744C>T, NM_001135599.3:c.594+5745C>T, NM_003238.4:c.510+5745C>T, NR_138148.1:n.1928+5745C>T, NR_138149.1:n.2012+5745C>T, XR_247036.1:n.1247+5745C>T, XR_247037.1:n.1163+5745C>T, XR_247038.1:n.1163+5745C>T
                          20.

                          rs2799090 [Homo sapiens]
                            GTGGTAGTCATACCTTCAACTCAGG[A/G]CTCCTTTGCACAGAAGGCAGGATAT
                            Chromosome:
                            1:218395487
                            Gene:
                            TGFB2 (GeneView)
                            Functional Consequence:
                            intron variant
                            Validated:
                            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                            Global MAF:
                            G=0.4189/2098
                            HGVS:
                            NC_000001.10:g.218568829A>G, NC_000001.11:g.218395487A>G, NG_027721.2:g.55154A>G, NM_001135599.3:c.431-9682A>G, NM_003238.4:c.347-9682A>G, NR_138148.1:n.1765-9682A>G, NR_138149.1:n.1849-9682A>G, XR_247036.1:n.1084-9682A>G, XR_247037.1:n.1000-9682A>G, XR_247038.1:n.1000-9682A>G

                            Display Settings:

                            Format
                            Items per page
                            Sort by

                            Send to:

                            Choose Destination

                            Supplemental Content

                            Find related data

                            Recent activity

                            Your browsing activity is empty.

                            Activity recording is turned off.

                            Turn recording back on

                            See more...
                            Support Center